The Problem of RNA

In my last post, I explained the reasons proteins are the most important molecules in our bodies for sustaining life. Proteins are produced by cells. To produce proteins, each cell contains a chemical factory that transcribes blueprints stored as genetic sequences into a coded message, transports the message outside the nucleus for processing and translates the message into proteins.

While it's not completely understood, each cell type (skeletal, brain, skin, etc.) knows when and where in the DNA to begin transcribing a particular gene sequence. Each gene sequence contains a region called the Promoter that indicates where to start transcribing the gene sequence and a Terminator which indicates where to stop.

The transcription process results in a single strand of base nucleotides called Ribonucleic Acid or RNA. Just as DNA contains an alphabet of four base nucleotides: A, T, C, G, RNA also contains an alphabet that represents it four base nucleotides: A, U, C, G. To construct a word in the RNA language, three of these letters are grouped together to form a codon, for example: ACG. The letters need not be unique, so UUU is also a valid codon.

The difference between DNA and RNA is that the nucleotide uracil in RNA replaces thymine in DNA.

Recall the DNA has two complementary strands bonded in a double-helix. When transcription begins, the two DNA strands split. Scientists refer to the two strands in different ways, but, essentially, one strand, call it the Template Strand, provides the pattern for transcription and the other strand, call it the Non-template Strand is the strand being transcribed. The promoter region is located on the Non-template strand.

non-template strand: CTGCCATTGTCAGACATGTATATA
template strand: GACGGTAACAGTCTGTACATATAT

An enzyme called RNA polymerase reads the two DNA strands to produce the RNA message chain which is the complement of the DNA template strand. Notice that since the DNA template stand and the non-template strand are also complementary, it follows that that the RNA message is a copy of the original, non-template strand (with uracil replacing thymine).

non-template strand: CTGCCATTGTCAGACATGTATA
template strand: GACGGTAACAGTCTGTACATAT (complement of non-template strand)
RNA produced: CUGCCAUUGUCAGACAUGUAUA (complement of template strand)

Once the RNA is produced, it is transported out of the nucleus into the cytoplasm so the process of protein construction can begin. During construction the codons in the RNA message are read by a chemical bar code reader called the ribosome. The ribosome maps, or translates, the RNA codons to amino acids and connects them into a polypeptide chain which will later be folded into a protein. The amino acids are brought to the ribosome by transfer RNA (tRNA) molecules.

The process of producing proteins from RNA is called Translation.

While my description is overly simplified, in actuality, the transcription of DNA into RNA, the transportation of RNA out of the cell's nucelus and into the cytoplasm and the translation of the RNA message is very complex. Failure of any component or step will likely result in harmful results. If the DNA codons are incorrectly translated or transcripted, the resulting protein will not function in the way it should. Muscular Dystrophy, for example, is believed to be the result of a premature termination of RNA translation.

The challenge for science is to explain the origins of RNA in the context of pure naturalism. To their credit, most biologists and geneticists realize and accept the challenge. They firmly believe the scientific method will reveal the natural origins of RNA.

Not me. For me, it's easier to believe a super-creative Mind created and initiated the entire process. The process is too complicated and relies on too many collaborating cellular mechanisms to have occured naturally.

Opponents might ask, "Then why didn't this Super-Mind create a perfect process? Why do mistakes occur that result in diseases like Muscular Dystrophy?"

My response is that these mistakes were not originally present in the original DNA and RNA, but came about as the result of humanity's rejection of its Creator. Though our present bodies may decay and die - the consequence of rejecting the Creator - it's possible to one day possess a perfect body with perfect DNA that perfectly constructs and maintains proteins.

Today, that's not so far fetched. We are not gods but even we hope to use genetic medicine to correct nature's malfunctions and reverse aging . If we can do this, if we can understand our genome well enough to mitigate the risk of malfunctions, surely a more advanced, Super-Intelligence would, too.

Therefore, I think it is more rational to believe a Super Intelligence initiated the processes that resulted in all the cellular processes and mechanisms we observe.

For additional details, see:

DNA-RNA-Protein
From DNA to RNA
Learn Genetics
Learning Your A, G, C's (and T, too)

The Argument from Induction

Belief in God is not only rational, but scientific. My argument is based on the following reasoning. I call it the Argument from Induction:

P1: Scientific experiments produce data models.
P2: Hypothesis formed from a data model using logical induction are deemed scientifically justified.
P3: The existence of God can be hypothesized from the data model.
Thus, belief in God is scientifically justified

A. Support for P1:Scientific experiments produce data models
The two approaches to forming scientific theories and producing a data model are:

1. Propose a hypothesis and attempt to refute it using experimentation
2. Collect data through experimentation and form the hypothesis

The two approaches are often used interchangeably, but there's a distinct difference between them. Forming an initial hypothesis, before experimentation, can lead to an unconscious bias that seeks to verify the hypothesis and reject the evidence that falsifies it. For example, before Galileo, scientists might have reasoned thusly:

Hypothesis: The Earth is the center of the Universe.
P1: The sun consistently rises in the east, travels across the sky and disappears in the west.
P2: The moon also travels in the same manner as the sun.
P3: The stars and constellations in the universe change their position as they move around the earth.
Therefore, since all heavenly bodies are observed to move across the earth's sky, the earth is the center of the universe.

Galileo falsified the geocentric (earth centered) hypothesis with the Copernican heliocentric (sun centered) hypothesis using data obtained from his astronomical observations. He used the second scientific approach where [a] an initial question is asked, such as, "Is the Earth the Center of the Universe?", [b] experiments are performed to produce a data model from which [c] the hypothesis is formed. I believe this methodology to be more accurate because the hypothesis can change as the data model changes.

In other words, as more knowledge is discovered, the hypothesis becomes more refined.

B. Support for P2:Hypothesis formed from a data model using logical induction are deemed scientifically justified.
Galileo's reliance on experimental data to refute the hypothesis of the earth's centrality lead Frances Bacon to argue in favor of an inductive approach where a hypotheses is formed after a data model has been constructed from repeated and verifiable experiments.

Moreover, the inductive approach predicts the same result will be repeated under similar circumstances, forming the basis for the modern mainstream belief that nature operates uniformly across the Universe.

For example, regarding the weak nuclear force modern scientists might reason thusly:

Datum 1: All matter is composed of atoms.
Datum 2: An Atom contains protons and electrons that form the atom's electrical charge.
Datum 3: Occasionally, protons change into neutrons and neutrons change into protons.
Datum 4: When the change occurs, a particle is emitted that maintains the atoms electric charge.
Datum 5: The change occurs too slowly for the Strong Force and the other known forces to account for it.
Induction: A very weak force must be responsible for the change.
Induction: Since it occurs within atoms, the weak force is fundamental to the laws of nature and is present in all atoms in the Universe.

For the most part, the science of Quantum Physics has been and continues to be inferred using the inductive approach.

However, there are problems with the inductive approach, the chief of which is the one introduced by philosopher David Hume who argued that, "...no man, having seen only one body move after being impelled by another, could infer that every other body will move after a like impulse. All inferences from experience, therefore, are effects of custom, not of reasoning."

Hume can be tough to digest for modern readers, but essentially, Hume argues logical induction is circular and can't be proven reliable. In more practical terms it means that one can't predict all sheep are white because only white sheep have been observed.

Thus, while the existence of the weak force may be a valid inference, to claim it exists uniformly and consistently throughout the universe is not.

Nevertheless, based on work by Mathematician Henri Poincaré, while experimental evidence may not guarantee certainty and uniformity, it increases the probability for them. Hence, Poincaré introduced the modern bias that experimentation, over time, produces a data model that strengthens or weakens the hypothesis. Thus, hypothesis that are formed from the data model using logical induction are deemed scientifically justified

Scientific fact, in reality, is not objective fact - it is an interpretation of the data model that its promoters believe has been strengthened by experimentation.

C. Support for P3:The existence of God can be hypothesized from the data model.
The fine tuning of the Universe, for example, is said to have occurred by random chance. There is an alternative interpretation that is just as rational. I argue the existence of God is not only rational, but also scientific since the same empirical data model is used to infer his existence.

For instance, consider the aforementioned weak force. If it were slightly stronger, lighter elements with smaller atomic numbers would fuse into heavier elements (with larger atomic numbers) more quickly because their neutrons would be transformed into protons (Datum 4 above). This would prevent simple, life sustaining molecules, like water, from forming because all the hydrogen would be turned into helium.

If the weak force were slightly weaker, there would be an abundance of lighter elements in the Universe (hydrogen and helium), but, little, if any, of the life forming heavier elements - like oxygen, nitrogen and carbon.

Therefore, the weak force must be tuned just right so life as we know it can form. The fact that the weak force is finely tuned is not controversial What is controversial is the reasons for its tuning. Is it from chance or from an intelligence?

Furthermore when one considers the extremely fine tuning of the other fundamental constants, it seems to me far more rational to infer the existence of an intelligent Mind who established these parameters than inferring random chance.

The God Induction
To factually claim the Universe resulted from chance is not justifiable from the scientific data alone. One must impose one's beliefs to suggest that induction. Given alternative inductions are possible from the data, as I've demonstrated, it is logical to suggest the Universe resulted from an intelligent source.

Thus, belief in God is scientifically justified.

Additional Reference
In addition to links embedded in the text, the following paper provides an excellent examination of the origins of the hypothesis, the philosophical reasoning and inductive logic that undergirds it and the implications for experimental design.
A Brief History of the Hypothesis

God Gene is Bad Science

Does a God Gene exist? No, and I argue this is just bad science and all of us should refrain from submitting bad science as evidence for anything.

Essentially, the God gene hypothesizes that (some) human beings are genetically predisposed to a belief in God. The idea is based on the book, The God Gene: How Faith is Hardwired into our Genes by Dean Hamer.

Simply put, there's no, and I mean, none, zip, zero, experimental evidence to support the God gene. Period. Still, even if such a gene existed in no way would it refute the existence of God, nor would it refute the religious experiences people have.

We already know the brain possess cognitive structures and chemical reactions that interpret sensory information - correct? Yet, we don't argue the objects our senses report are all in our head do we? Why not? Aren't all experiences merely the result of chemical processes and structures that exist only in our heads? To answer in the affirmative would be preposterous!

It's the same with the God Gene. Just because the brain is wired to sense deity doesn't mean deity is imagined. Besides, the Human Genome Project has scientifically demonstrated that humans are a complex mix of many interacting genes and environmental pressures - not from a single gene.

In short, the idea has no scientific credibility and even Hamer has since disowned the title of his own book.

If one wants to make a philosophical argument for the God Gene, and refer to scientific evidence to strengthen their argument - fine, but keep in mind the speculative nature of the subject…and it pays to keep current on the latest developments in science.

I say, when discussing religion and science, it’s important to be intellectually honest.

That’s my 2 cent argument, rip it to shreds if you can.