Cogent Faith

Is the Bible a Scientific Text?

2011-08-29T14:51:00.000-05:00

The Chicago Tribune recently ran a story that some Catholics still believe the sun revolves around the earth.

This baffles me.

Rationality is quality God gave us when he made us in his image. Can we not trust the data model collected by the scientific method? People may disagree on the interpretations of the cosmological data model, but, in this case, heliocentrism is, unquestionably, the rational interpretation, is it not?

I believe the Bible reflects the cosmology of its writers, but, it's not a scientific text. What do others believe?

The Apparent Contradiction of the Trinity Explained

2011-06-23T07:51:00.000-05:00

Recently, a co-worker asserted the Christian Doctrine of theTrinity was a logical contradiction. It seems to me those that posit the Trinity is a logical contradiction confuse or misunderstand the assertion Christians make about the Trinity.

Specifically, opponents say Christians assert the Bible teaches that God is one person AND God is three persons at the same time. In other words, 1 = 3. If that were true, then, yes, I would agree the Trinity would indeed be a logical contradiction.

A logical contradiction occurs when the truth of one propositon necessarily means the falshood of another proposition. Symbolically, a contradiction has the form of P &~P. Examples include:

Socrates is a man. Socrates is not a man.
Square circles
1 = 3
Married bachelors
All truth is relative

Logical contradictions violate one of the fundamental rules of thought: The Law of Non-Contradiction which asserts: "Nothing can be both P and not-P."

But, Christians are not asserting that 1=3 or that God is three persons in one person. Rather, they are resolving an apparent contradiction. Apparent contradictions are not equivalent to true logical contradictions - by any definition - because apparent contradictions can be resolved.

True logical contradictions can never be resolved.

The premise of the Trinitarian Doctrine is that God exists as three persons in one nature. Philosophically speaking, the word person, or personhood, refers to the totality of an entity’s non-physical attributes: intelligence, consciousness, creativity, will, self-identity, etc. Obviously, humans have personhood, but, personhood is not restricted to Humans. In fact, some scientists argue that Dolphins should be considered “non-human” persons.

God possesses all the qualities of personhood.

The word nature refers to the distinguishing characteristics that an entity possesses naturally. Human nature, for instance, consists of physical flesh and personhood. God’s nature is composed of spirit and personhood.

Thus, all entities have natures, but not all natures are physical.

Some entities, like God and Angels, possess non-physical natures.

Now here’s the real thrust of my argument. If an entity’s nature could only support one self-identity, or one person, then the Trinitarian concept would be a real contradiction – an absurdity and not embraced. But, there is no reason to believe an entity is restricted to one nature with one self-identity.

The burden of proof lies with opponents of the Trinitian Doctrine to prove an entity’s nature can only support one person.

It may be a mystery to us HOW an entity can possess one nature with three persons, but our ignorance does not a contradiction make.

Thus, the Christian Doctrine of theTrinity is not a real, logical contradiction but an apparent contradiction that is easily resolved.

Beware of the "Tu Quoque" Fallacy

2011-06-03T10:24:00.001-05:00

"Tu Quoque" pronounced ("two coke" or even "two qwo qway" ) is a Latin phrase that means, "You, too." In conversations, it is often used as an attempt to dismiss or dismiss an opposing viewpoint because the person with the opposing viewpoint has acted inconsistently with that viewpoint.

"Tu Quoque" is a non-sequitur logical fallacy (meaning, "it does not follow") and, thus, is a thinking error. Semantically, the fallacy means, "If you don't follow your own rule perfectly, how can you expect others to follow it?"

Why is it a thinking error?

Just because a person makes an inconsistent assertion does not make that assertion false. It might indicate the person is hypocritical, but not that his assertion is false.

Unwarranted assumptions and ""Tu Quoque" errors are two of the most common (and, IMHO, the most egregious) thinking errors people make.

According to the Wikipedia, the form for the argument that commits this error is the following:

A makes criticism P.
A is also guilty of P.
Therefore, P is dismissed.

Teenagers sometimes use this argument in the following manner:

Mom: "Premarital sex is morally wrong. Don't do it."
Daughter: "Did you have premarital sex?"
Mom: "Yes."
Daughter: "Then who are you to tell me not to?"

The guilt, or innocence, of mom's past behavior is completely irrelevant to the issue of morality. If premarital sex is morally wrong, then it was morally wrong when mom did it and it will still be wrong if daughter does it.

Other examples to point out the absurdity of the error:

Jill: "I think the gun control bill shouldn't be supported because it won't be effective and will waste money."
Bill: "Well, just last month you supported the bill. So I guess you're wrong now."

"How can you tell me not to experiment with drugs when you did the same thing as a teenager?"

Beware of the "Tu Quoque" fallacy and refrain from committing it! Parents, PLEASE teaching your children critical thinking skills. It's these skills that will help make them responsible adults, and help lead them to Truth.

Why Men Have Nipples

2011-04-21T12:07:00.000-05:00

Teens often ask religious speakers,"Why do men have nipples?" Funny, but behind the humor is a sincere question.

So, earlier this morning, as I read Homily 5 from Severian of Gabala, a 4th century Christian writer, imagine my surprise when Severian asked the very same question!

His answer: "For comliness, for proper adornment; just as with builders, some things are done out of necessity, others for comliness, so too, God both adorned the human being and equipped him for meeting needs."

What this means to me is symmetry. God made humans, both, for form and function as any good architect would do.

Are Long Life Spans in the Old Testament Plausible?

2011-03-09T05:55:00.000-06:00

While not “proof” in the laboratory sense, the following web site provides 5 reasons why it is reasonable to believe the long life spans in the Bible are plausible.
You can read the article for the details, but the 5 reasons are:

1.Reactive Oxygen Species (ROS)
Discoveries in ROS suggest that one way God could have designed humanity to live for 900 years and then acted to decrease man's life expectancy at the time of the Flood would be to make subtle changes in the level of SOD and catalase enzyme expression within cells.

2. Caloric Restriction
Through a vegetarian diet, God could have used caloric restriction to help extend pre-Flood life spans.

3. Telomere Loss
God could have changed human life expectancy simply by varying telomerase activity. Alternatively, God may have complemented an increase in radiation levels (via a supernova event ) with a reduction in telomerase activity so as to minimize human suffering in the context of shortened life expectancy.

4. Genome Size
Larger genome sizes correlate with longer life spans. The human genome has a large amount of non-coding DNA. The non-coding DNA may have performed a critical function at one time to extend lifespans.

5. Vela Supernova
Radiation from the Vela supernova bathed the Earth and affected life expectancy. Moreover, a significant radiation event such as Vela would explain the mathematical curve, the gradual, exponential reduction in life spans, from about 900 to 120 years reported in Genesis 11.

Why are these reasons plausible? Because the scientists engaged in age research are trying to find ways to counter-act the above. If humans with their limited knowledge and power can alter life spans, how much more so can God who is unlimited in knowledge and power?

Is the Bible innerant?

2011-02-04T09:35:00.002-06:00

Is the Bible innerant (without error)? We say the bible is inerrant, or without error, in its proclamation of truth.

Inerrancy simply means that the Bible communicates the Truth using approximations, free quotations, and different accounts of the same event without contradiction.

Each writer communicates God’s truth as they perceive it even though their accounts vary. Just as we do when we communicate, Bible writers used stories, similies, analogies and metaphors to communicate their message.

Innerrancy doesn’t guarantee every account will be identical, word for word, but it does guarantee that every account will commnuicate God's Truth.

Inerrancy also includes parables, metaphors and illustrations. Nobody believes Jesus is literally a vine when he says, " I am the vine; you are the branches" or a gate when he says, "I am the gate." Nevertheless, we understand his use of this imagery to make his point.

What is the innerant truth of the Bible? That God loves humanity so much that he sent his only son Jesus to die for us and that whosoever believes and trusts in him will receive forgivness of sins and receive eternal life. Jesus is God’s divine plan for humanity. He is the reason the Holy Spirit inspired men to write the Bible and it's in Jesus we find our purpose and reason for existence.

Do All Religions Lead to God?

2011-01-15T08:39:00.003-06:00

Do All Religions Lead to God? Some say "Indeed they can, all religion is a guide...similar to an atlas. There are MANY different paths to the same destination."

These people mean well, but a problem quickly appears when one reviews the fundamental doctrines of the world's religions - they contradict each other.

In logic, contradictions occur when one or more statements lead to opposing results and both results can not be true:

For example:

Statement 1: Sally is a girl.
Statement 2: Sally is not a girl.
Either Sally is a girl or she is not a girl. She can't be both.

Contradictions also occur in self-refuting statements:

Example 1: Tom is a married bachelor.
Tom is either a bachelor or Tom is married - he can't be both.

Example 2: All truth is relative.
The statement is asserting, absolutely, that all truth is relative. But, if that's the case, then the statement contradicts itself because it asserts all truth is relative.

In order for all religions to lead to God, one or more religions would need to discard or compromise their fundamental doctrine about what they believe leads to God. Try reconciling Christianity and, say, Paganism without compromising the doctrine and traditions or one or both. It can't be done because their fundamental beliefs contradict each other.

Therefore, when it comes to religions, the logical possibilities are only two:

1. All religions can be wrong
2. One or more of them can be correct

All of them can't be correct since a logical contradiction would result.

The challenge is to discover the religions, or religion, that best describes reality.

Proof of God

2011-01-15T07:52:00.001-06:00

Stephen D. Unwin is a theoretical physicist in the field of Quantum Gravity. In his book, The Probability of God, Unwin sets out to mathematically prove the existence of God. He concludes there's a 67% probability for God's existence.
Dr. Unwin's Home page

Kurt Goedel, a gifted logician and mathematician, is best known for his incompleteness theorems which basically posit that all formal systems are incomplete because each of them contains, at any given time, more true statements than it can possibly prove according to its own defining set of rules.

But, Goedel also sketched a revised version of Anselm's ontological argument for the existence of God that wasn't published until after Goedel's death. His proof is more elaborate than Anslem's and used a system of logic known as Modal Logic that provides a useful language to discuss God's existence because it distinguishes between necessary truths and contingent truths.

Goedel's Ontological Proof

Was the New Testament Influenced by Pagan Religions?

2011-01-15T07:47:00.000-06:00

The charge that Christianity borrowed from pagan mystery religions to form her doctrinal practices has been with the Church since her formation. Could this be true?

The short answer is no, the New Testament was not influenced by pagan religions which a careful and unbiased examination of history will reveal.

The long answer is given by Ronald Nash of the Christian Research Institute.

Was the New Testament Influenced by Pagan Religions?

The Hidden Face of God

2011-01-15T07:40:00.001-06:00

Former atheist Andrew Flew credits physicist Gerald Schroeder's book, The Hidden Face of God, as the driving force behind his (Flew's) acceptance of a supernatural force at work in Cosmos.

Schroeder's book demonstrates that belief in God is not only acceptable but scientifically and rationally based.

Also available is a DVD that explores the interface between God and Science. In Has Science Discovered God?, Flew is joined with Schroeder and Dr. John Haldane of St. Andrew’s University to discuss the origins of the Universe, life, consciousness and the existence of God.

For those needing it, this DVD and Schroeder's book provides the scientific evidence to justify a belief in God.

Descartes Rules for True Conclusions‏

2010-06-09T20:04:00.001-05:00

In the Discourse, Descartes described four rules he established to make sure he always came to true conclusions.

Doubt everything. “The first was never to accept anything as true if I did not know clearly that it was so … and to include nothing in my judgments apart from whatever appeared so clearly and distinctly to my mind that I had no opportunity to cast doubt on it.”
Break every problem down into smaller parts.
Solve the simplest problems first, and build from there.
Be thorough. “The final rule was: In all cases, to make such comprehensive enumerations and such general reviews that I was certain not to omit anything.”

By following these simple guidelines, he said, “There cannot be anything so remote that it cannot eventually be reached nor anything so hidden that it cannot be uncovered.” More.

In my experience, and in my opinion, item 4 is the rule most often violated. Many self-proclaimed skeptics do a great job of rules 1-3, but completely miss number 4 resulting in unwarranted assumptions leading to irrational conclusions. Prime examples are Richard Dawkins and Christopher Hutchins.

Smart guys, yes, but not thorough in their research.

Is Morality an Innate Human Trait?

2010-06-03T18:53:00.002-05:00

According to Dr. Paul Bloom, a psychology professor at Yale University, "A growing body of evidence suggests that humans do have a rudimentary moral sense from the very start of life."

In a research study, Bloom designed a set of experiments to test baby morality. The result? According to Bloom, "Babies possess certain moral foundations — the capacity and willingness to judge the actions of others, some sense of justice, gut responses to altruism and nastiness."

While Bloom is quick to state the research does not imply divine intervention, it certainly challenges the mainstream position that children are moral blank slates upon which anything can be written.

Proof for Life After Death?

2010-06-03T06:43:00.002-05:00

I've been skeptical for decades about the experiences near death survivors report for life after death. It's not that I don't believe in life after death - I do - but, I've hesitated to accept NDE's (near death experiences) as evidence for it. However, my skepticism is waning as the evidence weights in favor of NDEs as proof that consciousness survives after death.

In addition to the research conducted by pioneer Dr. Raymond Moody, cardiologist Dr. Pim van Lommel has written a book (June 8 release date) that provides compelling evidence on the survival of consciousness after physical death which can not be explained by mainstream models of the brain and its neurochemistry.

Consciousness Beyond Life: The Science of the Near-Death Experience

Van Lommel's book is based on research published by Van Lommel and other researchers in The Lancet; 2001; 358: 2039-45. a leading medical journal:

Near-death experience in survivors of cardiac arrest: a prospective study in the Netherlands

The fact that Van Lommel and his research team are cardiologists make them worthy of our attention. Apparently, their research attracted the attention of other doctors. In an interview with IANDS' Vice-President Dr. Jeffrey Long, Dr van Lommel said he , "received more than 265 e-mails in just four weeks, including a lot from physicians who wrote to me about their own NDEs!"

One of these doctors is Pam Kircher who was Chief of Family Medicine at Memorial Southwest Hospital in Houston, Texas. She experienced an NDE as a child. In her comments on Van Lommel's research, she encourages people to share Von Lommel's study with their family doctors.

Dr. Van Lommel offers additional information concerning the study in his reply to skeptic Michael Shermer:

Moreover, in his book Life After Death The Evidence, Dinesh D'Souza, Stanford scholar and Robert and Karen Rishwain Fellow at the Hoover Institution at Stanford University offers a case study and documents evidence from science, history, philosophy and psychology that shows it is more reasonable to believe that consciousness survives the body after death than not. Here's a video interview with D'Souza by Fox News.

As the evidence mounts, skeptics in life after death will be hard pressed to rationally maintain their position and all of us can be comforted that our loved ones who have passed on on still survive.

David's Palace Likely Found

2010-05-27T10:55:00.002-05:00

Once again archeology provides strong evidence for the Bible's historicity. Dr. Eilat Mazar, world authority on Jerusalem's past, has unearthed very strong evidence for David's palace.

The scientific and archeological evidence is simply overwhelming. How any intellectually honest and rational person could deny God's existence is beyond me. Those that do are ignorant of the evidence or denying it because accepting God's existence might imply moral accountability.

Cumlative Proof For God's Existence

2010-05-26T23:11:00.000-05:00

Excellent site by former atheist.

http://www.iloveatheists.com/about_us/cumulative-case-god

Archaeological Evidence Favors Biblical Record

2010-01-11T08:16:00.002-06:00

The archaeological evidence continues to provide support for the Bible, refuting claims by liberal scholars.

For decades, now, liberal scholars have loudly and publically asserted as fact the Bible can not be as old as it claims. When will liberal scholars accept that proving a negative is not only illogical but makes them look less than intelligent? This discovery would silence a reasonable person, so I doubt it will silence liberal scholars.

Pottery shard indicates Old Testament far older than liberal scholars thought.

The God Particle

2009-12-23T09:28:00.002-06:00

The God Particle is the nickname given to a theorized sub-atomic particle called the Higgs Boson particle, or simply the Higgs particle. The nickname comes from the premise the particle is the source of all mass, or weight, in the Universe.

All matter has the property of mass - you, me, dogs, atoms, sub-atomic particles, etc. The Higgs particle explains WHY all matter has mass.

Actually, the Higgs particle carries a field that gives mass to all matter. The field permeates EVERYTHING and exists EVERYWHERE. Think of a Jedi night in Star Wars as a carrier of the force. The Higgs particle is the carrier for the Higgs field.

As objects (me, you, cars, airplanes, sub-atomic particles, etc) move through the Higgs field, resistance is encountered. Resistance to the Higgs force produces mass and weight. Objects that have little resistance to the Higgs force have smaller mass and weight. For example, the photon, a particle of light, offers no resistance to the Higgs force and thus, has zero mass and weight. Objects like you and I have mass and weight because we cause resistance in the field.

The Higgs particle is essential to the standard model of physics which posits that everything in the Universe can be explained from twelve basic building blocks called fundamental particles that are governed by four fundamental forces (except for gravity which Einstein posited in his general theory of relativity is NOT the result of a particle carrying a field).

The problem is that no one has ever discovered a Higgs particle. Hopes are high, however, the ATLAS experiment at the Large Hadron Collider on Geneva will locate the Higgs Boson particle which would confirm the standard model of physics.

Why should you care?

The issue is that the standard model of physics fails to explain mass. If the Higgs particle is not discovered the standard model of physics will need to be rewritten. Yikes!

The discovery has the potential to be the greatest scientific discovery of the century leading to a unified theory of everything or the greatest scientific mistake. The entire world of physics waits with eager anticipation.

For those desiring to know more, check out:
http://www.school-for-champions.com/Science/matter.htm
http://public.web.cern.ch/Public/en/Science/StandardModel-en.html
http://public.web.cern.ch/public/en/LHC/LHC-en.html
http://public.web.cern.ch/public/en/Science/Higgs-en.html
http://www.time.com/time/health/article/0,8599,1729139,00.html
http://www.aei.mpg.de/einsteinOnline/en/elementary/generalRT/GeomGravity/index.html

The Science of Reasoning

2009-12-11T11:22:00.002-06:00

Reasoning is an inherent, natural function of the brain. Therefore, to reason about reality is natural. The question is not, “Do we reason?” but, “Does our reasoning lead to us closer to or further from reality?”

I believe a reality exists independently of what I believe about it and while I don’t believe reality is comprehensively known or understood, we know enough to make statements about it. Consider these statements of reality:

The world is round (even if I believe it is flat)
2+2=4 (even if I can't add)
The planets in our solar system revolve around the sun (even if I don't exist)
The sun rises in the east and sets in the west (even if I’m blind)
The earth orbits the sun (even though it seems as if the sun moves around the earth)

The statements above also reveal important characteristics about the nature of reality:

Reality is independent of belief
Reality is universal (2+2=4 is the same for everyone, even if they can’t add)
Reality is not subjective – people don’t define it
Reality is not contradictory – 2+2 will always equal 4
Reality is discovered – not invented

Statements about reality are considered true when they agree with the nature of reality, or stated another way, when they don’t contradict the nature of reality. Truth, according to this definition, must correspond with reality.

Reasoning is the process of determining truth. Logic is the study of the methods and principles used to distinguish correct reasoning from incorrect reasoning. Author of several books on logic and mathematics, Irving M. Copi wrote, "The distinction between correct and incorrect reasoning is the central problem with which logic deals."

Put more simply, logic is the science of reasoning.

Still, even our best logic won’t guarantee we will arrive at truth. History provides many examples of beliefs we thought we true, but, later, turned out to be wrong. Nevertheless, by ensuring our logic is correct, I believe we are more likely to get closer to the truth than with incorrect logic.

Reasoning can be deductive or inductive. In a deductive reasoning, a claim is made that is supported by statements which are either true or false. For example, the claim that the Greek Philosopher Socrates was a mortal might be supported in the following manner:

All humans are mortal.
Socrates was a human.
Therefore, Socrates was mortal.

An argument is truth claim supported by collection of true/false statements.

Deductive arguments can be valid or invalid. This is important to understand because deductive arguments can be valid but untrue. For example:

All humans have 3 legs.
Roy is a human.
Therefore, Roy has 3 legs.

The reasoning above has a valid form but the statement that all humans have 3 legs make the conclusion false.

Negating any of the deductive argument’s premises make the entire argument false. On the other hand, if all the statements are true, and the form is valid, as in the Socrates example, then the conclusion is certain and becomes a true statement about reality.

A deductive argument made popular by Dr. William Lane Craig for the existence of God goes as follows:

Whatever begins to exist has a cause.
The universe began to exist.
Therefore, the universe requires a cause.

From the argument above, we can claim Universe must have been caused by a Transcendent Creator.

Deductive reasoning uses general facts to make a specific truth claim.

Sometimes, not all the facts about reality are known or even can be known. In this case, we examine what we do know and make a statement that is probably, but not certainly true.

An inductive argument uses specific facts to make a general truth claim.

For example:

Complexity implies a designer.
The universe is highly complex.
Therefore, the universe probably has a designer

Unlike the deductive argument, in an inductive argument, the statements provide support for the conclusion, but the conclusion doesn't necessarily follow. Inductive arguments are never certain, but evaluated as better or worse based on the strength of their propositions.

Science is based on inductive reasoning.

In summary, reasoning is a skill that can be learned and involves using the Laws of Thought as a foundation to construct a worldview composed of beliefs, opinions and images that are justified by deductive and inductive reasoning.

Was Mary a Virgin?

2009-11-05T06:10:00.003-06:00

Recently, I was asked if I believed Mary, the mother of Jesus, was a virgin. My response was, "Yes!" While I realize the Bible contains allegory and metaphor, in this case, this is not one of them.
From the beginning, the Christian Church has accepted Mary's viginity as historical fact. Even today. he Eastern Orthodox Church, the Roman Catholic Church, most traditonal Protestant groups believe Jesus Christ was conceived in Mary's womb by the influence of the Holy Spirit and not a man.

Why? Because the authors of scripture stated it Mary was a Virgin:

The Apostle Luke records Mary's own words, "How can this be, since I am a virgin?"

Note: The Greek words used for virgin, anēr, ou, and ginōskō translate to: a betrothed person who has not had sexual intercourse.

Isaiah 7:14; Matthew 1:23; Luke 1:27, all refer to Mary as a virgin.

Moreoever, Luke emphasizes the Holy Spirit is the father - not a man. Matthew says it twice in Matthew 1:18 and Matthew 1:20.

Furthermore, Matthew 1:25 says, "He had no relations with her until she bore a son, and he named him Jesus." He is Joseph and her is Mary. Restated, Joseph, did not have sexual relations with Mary, until she bore a son and mamed him Jesus."

The meaning of scripture is crystal clear. Joseph and Mary did not have sexual relations until after Jesus was born.

What about the charge that the early Church knew Mary was not a virgin but developed it over time?

In addition to the ancient Biblical manuscripts, an analysis of historical Church documents reveal the following:

1. According to the Protoevangelium of James, written around 120 AD, Joseph "wept bitterly" and when he discovered Mary was pregnant and charged her with infidelity. By law, Joseph was required to reported her condition to the temple authorities, but when he did, they thought the couple had married in secret and even accused Joseph of lying and defiling Mary's purity.

2. Tertullian, a Church Partriarch wrote 213 AD, “And indeed it was a virgin, about to marry once for all after her delivery, who gave birth to Christ, in order that each title of sanctity might be fulfilled in Christ's parentage, by means of a mother who was both virgin, and wife of one husband.”

3. John Chrysostom, in Homily 5 on on Matthew, (370 AD) informs us, "before the birth the Virgin was wholly untouched by man."

4. The Creed of Epiphanius states Jesus "was conceived perfectly through the Holy Ghost of the holy ever-virgin Mary..."

5. Jerome, arguing against Helvidius, wrote, "I must call upon the Holy Spirit to express His meaning by my mouth and defend the virginity of the Blessed Mary."

Additionally, Church patriarchs considered the contrary premise that Mary was not a virgin to be madness and heresy:

•"madness and blasphemy" by Gennadius (De dogm. eccl., lxix),
•"madness" by Origen (in Luc., h, vii),
•"sacrilege" by St. Ambrose (De instit. virg., V, xxxv),
•"impiety and smacking of atheism" by Philostorgius (VI, 2),
•"perfidy" by St. Bede (hom. v, and xxii),
•"full of blasphemies" by the author of Prædestin. (i, 84),
•"perfidy of the Jews" by Pope Siricius (ep. ix, 3),
•"heresy" by St. Augustine (De Hær. h., lvi).

So, despite the assertion of some the the belief in Mary's virginity developed over time has no basis in reality. The Early Church certainly believed Mary was a virgin from the beginning.

But, what about the charge by Richard Dawkins and others that English Bibles have mistranslated "young woman" into virgin? Is that true?

No. Just as in English, the context needs to be analyzed.

Consider the text from Matthew which is a quote from Isaiah 7:14:

"BEHOLD, THE VIRGIN SHALL BE WITH CHILD AND SHALL BEAR A SON, AND THEY SHALL CALL HIS NAME IMMANUEL," which translated means, "GOD WITH US."

The Hebrew word Isaiah used for the word "virgin" is almah which some argue means "young woman.” The agument Dawkins and others assert rests solely on another word, bethulah which they claim claim would have been used for virgin instead of almah if the author actually meant "virgin" and not "young woman."

However, they haven't done their homework. Consider the usage of the word from a word search in the Blue Letter Bible for almah:

1.Genesis 24:43 uses the word almah to refer to Rebekah, who would become the Isaac's wife. However, in verse 16, she is referrred to as bethulah, a virgin.

2.In Exodus 2:8, almah is used in reference to Miriam, Moses's older sister, but still a very young girl who is certainly a virgin.

3. Song of Solomon 6:8 contrasts queens, concubines and maidens (almah), indicating these particular maidens have not been with men.

Thus, while it's true almah can simply mean "young woman", it can ALSO mean "young virgin woman" depending on the context.

Moreover, the Hebrew word elem is the masculine form of almah. For example, in 1 Samuel 17:56 it is used to refer to David, the youth who had just killed Goliath. When you consider the strong taboos against pre-marital sex in the Hebrew community, David was certainly a teen aged virgin.

Therefore, the Hebrew word elem irefers to a young man who does not yet have a woman (wife) and almah is a young woman who does not yet have a man (husband). Both are virgins in the classical meaning of the word.

Old Testament scholar and Hebrew instructor R. Laird Harris, in the Theological Wordbook of the Old Testament, wrote: "There is no instance where it can be proved that alma designates a young woman who is not a virgin.”

In fact, Martin Luther argued almah is more appropriate in the context of Isaiah than bethulah:

"...almah is even more appropriate here than bethulah. It is also more precise to say, "Behold, a maiden is with child," than to say, "A virgin is with child." For "virgin" is an all-embracing term which might also be applied to a woman of fifty or sixty who is no longer capable of childbearing. But "maiden" denotes specifically a young woman, nubile, capable of childbearing, but still a virgin; it includes not only the virginity, but also the youthfulness and the potential for childbearing."

The evidence from the Bible, from Chuch history and Jewish culture is overwhelming. Almah means "young female virgin of marriageable age" and, hence, Mary was indeed a vigin. Reason demands it.

Why is it important that Mary was a virgin?
Because Jesus was born without a sin nature. Otherwise, he would not have qualified as the perfect sacrifice and humanity would still be separated from God without hope of reconciliation.

Why didn't Jesus inherit sin from Mary?
Because sin is inherited from fathers, not mothers. The virgin birth circumvented the transmission of the sin nature and allowed the eternal God to become a perfect man.

What about the curse God made that no ancestor of Jehoiakim (David's ancestor) would rule on David's throne? Doesn't the Bible indicate Jesus assumes David's throne and is an ancestor of David?
If Joseph had been Jesus’ father, he would have been disqualified from assuming David’s throne. However, since he was not and Mary also descended from David through Nathan, another son of David, Jesus was a legitimate heir. Nathan's lineage was not cursed.

Atheists Arguments are Irrational

2009-10-16T08:18:00.002-05:00

Atheists Arguments are irrational for several reasons.

1. Inductive reasoning is uncertain.
Inductive reasoning assumes a general conclusion based on specific facts or patterns. Scientists use inductive reasoning as the basis for building theories. Experiments yield results which are used to create theories that explain the results and allows for prediction of future knowledge.

Here's the problem: inductive reasoning is uncertain (yes, the implication is that science is also uncertain. gasp!)

For example, for centuries, the mainstream scholarly opinion was that black swans did not exist. Much of the world had been discovered and no evidence for black swans had been found. Thus, they inductively reasoned:

No evidence for the existence of black swans exist.
Therefore, all swans are black.

Imagine their shock when black swans were discovered in Australia in the 17th century! The discovery of black swans should have taught us to be wary of making universal assumptions and underestimating what we don't know.

Sadly, it didn't. When atheists state, "There is no God" they are engaging in same inductive based reasoning as their black swan predecessors:

No evidence for the existence of God exists.
Therefore, God does not exist.

People who insist on evidence alone for their beliefs are known as logical empiricists (aka logical positivists).

2. Logical Positivism is irrational.
Logical empiricists places high value on evidence as a confirmation for knowledge. They insist on the principle of verifiability meaning that only knowledge that can be proven true or false - by the evidence - is meaningful. In other words, empirical verifiability is the ultimate truth standard and any possibility not represented by the evidence is rejected out of hand.

I've often heard logical empiricists state with great pomp, "I have no beliefs! Only facts as proven by the evidence!"

Yet, despite their belief in the truth of their own statement, sustaining a logical empiricist position is difficult, if not impossible, since it is based on inductive reasoning and, hence, uncertainty and assumption.

Logical empiricists don't seem to understand that absence of evidence is not evidence of absence.

Moreover, logical positivism is self-contradictory. Since the principle of verifiability itself cannot be emperically proven true or false by means of experience, then, logical positivism can not be meaningful either.

For these and other reasons logical empiricism has been replaced by other philosophical methodologies despite the fact that academics - especially the sciences - still teach this weak approach. In my opinion, , it has lead many a young and brilliant mind astray.

In its attempt to produce free thinkers, academia has unwittingly produced limited thinkers.

3. Biased Interpretation
A person who is limited in their thinking is biased in their interpretation of the evidence. Many limited thinkers believe they are unbiased, but, in reality, they are anything but.

Consider this statement by Richard Dawkins:

"You cannot be both sane and well educated and disbelieve in evolution. The evidence is so strong that any sane, educated person has got to believe in evolution."

See what I mean? Dawkins sets up a false dilemma (a logical fallacy, by the way) that limits the conclusion to one of two possible outcomes: Believe in evolution or risk insanity and ignorance. Because he can imagine no other scenario, Dawkins goes on to say:

"Now there are plenty of sane, educated, religious people: there are professors of theology, and there are bishops ... and so obviously they all believe in evolution or they wouldn't have gotten where they have because they would be too stupid or too ignorant. So, it is a fact that there are evolutionists who are religious and there are religious people who are evolutionists."

It's this kind of constrained reasoning that lead me away from logical positivism taught in school, to support a different methodology based on skeptical empiricism meaning that theories resulting from experiments are just one of possbily several interpretations of the evidence and is not exhaustive of all other possibilities.

For example, the arguments from natural theology, in my mind, make a far more compelling case for the Universe's existence brought about by a Supreme Rational Mind than mere random chance as atheists promote. Could my interpretation be incorrect? Of course. But, I certainly don't constrain or force my reasoning to fit my bias and I don't make statements like:

"You cannot be both sane and well educated and disbelieve in God. The evidence is so strong that any sane, educated person has got to believe in God."

I realize that people can be both educated and sane, yet, still disbelieve in God.

Conclusion
If anything my bias for clear and rational thinking biases me against atheism. As as student of logic, I can't and won't allow myself to to erect a worldview based on the uncertainly of inductive reasoning. I'm not saying that that inductive reasoning is inherently flawed and leads to bad thinking. On the contrary, inductive reasoning has lead to advances in medicine, technology, and science.

Inductive logic can be a very good thing.

What I am saying is that we need to be critical of our thinking processes to mitigate the slide into logical empiricism and biased interpretation which can and does happen as evidenced by the intellectual weakness of the atheistic position. In my opinion, atheism is an illogical position to maintain.

Another Reason to Suspect God Exists

2009-09-12T12:05:00.002-05:00

Density is defined as a material's mass unit per volume, or the ratio (concentration) of matter contained in a given volume. For most liquids, freezing decreases mass and increases density causing it to become smaller and heavier.

Not so with water.

When water freezes, a crystallized lattice (like a web) of hydrogen-bonded molecules forms that contains more open spaces than liquid water causing the structure to expand and become less dense than liquid water.

That's why ice cubes float in a glass of water and water freezes from the top down. It's also why freezing sea water produces drinkable water - the salt in the water won't crystallize.

Think about the effect on life if water behaved like other liquids.

- Temperatures on islands and other land masses surrounded by water would not have stabilized.

- Even the temperature of the human body would not have stablized.

- Lakes and oceans would freeze all they life they contain, ultimately affecting the oxygen levels in the atmosphere.

In short, if the molecular properties of water were just slightly different, life as we know it would not have formed and survived.

For me, it seems highly unlikely that water's unique chemical properties that are necessary for life would have developed by mere chance. It's far more reasonable to believe a rational mind gave water it's unique properties to support our particular form of life.

BioLogos

2009-05-15T03:31:00.001-05:00

Dr. Francis Collins - remember him? He's the former director of the Human Genome Project . Recently Collins launched his web site, BioLogos, to harmonize science and spirituality.

"BioLogos is led by a team of believing scientists who are committed to promoting a perspective of both theological and scientific soundness, which takes seriously the claims of theism and of evolution, and finds compelling evidence for their compatibility."

Like Antony Flew, the "worlds most notorious atheist", Collins bases his theism on the evidence from science and in his book, The Language of God: A Scientist Presents Evidence for Belief, Collins recounts his transition from atheism to Christianity.

Collins believes God used evolution to as the mechanism to create life.

Not surprisingly, Collins is often criticized by members of the two camps he is attempting to harmonize. Still, his website deserves a look no matter where you stand in the debate....and it IS a debate which neither side can end conclusively. Like me, Collins has examined the scientific data model and inducted that God is the best explanation for the evidence. You'll need to decide for yourself, of course, but, for intellectual honesty, at least examine his reasons before rejecting them out of hand.

Incidentally, Check out this debate in Time Magazine between Collins and Richard Dawkins. In his closing statement, Dawkins says, " If there is a God, it's going to be a whole lot bigger and a whole lot more incomprehensible than anything that any theologian of any religion has ever proposed." To which I say, precisely, Dr. Dawkins! God exists apart from and is completely incomprehensible by humanity. Moreover, If it weren't for God's specific manifestation in the physical form of Jesus the Nazarene, humanity would be forever separated from and ignorant of God's personal nature.

Assumptions about RNA Formation

2009-05-14T19:00:00.005-05:00

The May 14 issue of Nature reports that scientists, for the first time, have created a building block of RNA (believed by some to be a precursor to DNA) from simple chemicals in an environment that modeled the conditions of early Earth.

According to the researchers, the experiment strengthens the RNA World hypothesis which theorizes RNA was the chemical basis for the self-organized structures that led to the formation of the cell.

Until now, or so the researchers argue, nobody has demonstrated that RNA could even form in earth's early environment. That's a big problem for RNA World proponents.

But does the research actually support their assertion? I say no.

First, the experiment was riddled with John Sutherland's assumptions about the conditions of early life on earth (his words, not mine) and the subsequent chemical reactionary chain that lead from RNA to cells.

Donna Blackmond, a chemist at Imperial College London and a proponent, even admitted, "We don't know if these chemical steps reflect what actually happened, but before this work there were large doubts that it could happen at all."

Robert Shapiro, professor emeritus of chemistry at New York University, believes the experiment was "elegant", but, "it had nothing to do with the origin of life on Earth whatsoever."

And, regarding the sequence of steps Sutherland and his team used to produce the results, James Ferris, of the Rensselaer Polytechnic Institute, said "It’s not as simple as putting compounds in a beaker and mixing it up. It’s a series of steps. You still have to stop and purify and then do the next step, and that probably didn’t happen in the ancient world.”

Second. The experiment was biased! Why hasn't anyone in the scientific community pointed this out? Sutherland even admits his goal - his goal!!! - is "to get a living system (RNA) emerging from a one-pot experiment. We can pull this off. We just need to know what the constraints on the conditions are first."

Aren't self-organzing chemicals and structures supposed to occur spontaneously? Scientific objectivity? What's that? I completely believe he will achieve his goal because he will contrive the conditions and the experiment, to make it so. But that will explain nothing about the actual, natural origins of life in pre-biotic earth.

At best, Sutherland's team described a possible chemical sequence - insight - in which a building block of life emerged, but not life itself.

Nevertheless, a true believer, and despite his admission that his is only a related chemistry, Sutherland demonstrates his faith is firmly planted in his assumptions, based on speculation when he says:

“It’s related chemistry,” Sutherland says. “That’s how it must have been in the very beginning — a series of fundamental reactions that could make all four types of RNA molecule.”

Yeah, it MUST have been that way in the very beginning.

Sutherland's absolute faith in his own assumptions demonstrates he is just as committed to his religion as theists are to theirs.

Is Faith Blind?

2009-03-05T21:18:00.003-06:00

Is it possible to establish a foundation of certainty on which we can erect a belief structure that is not based on blind faith?

Yes, but one must begin with the most basic truth that is intuitively provable and undeniably certain discovered by the French philosopher René Descartes. It was Descartes who said "I think, therefore, I am". We've all heard this famous quote, but, how many realize the significance of his statement?

Descartes proved the existence of self is impossible to doubt because the mere act of thinking about something - anything, regardless of its truth value - necessarily implies there must be something engaged in that activity, namely an “I.” Even the act of self-doubt proves that something exists to doubt its own existence. And, since this conclusion derives not from sensory input nor does it depend on the reality of an external world, it serves as a self-evident truth, an axiom, from which other truths can be determined or inferred.

The existence of self, then, becomes the foundation of certainty on which a belief structure can be erected.

Moreover, the certainty of my existence implies that at least one absolute truth exists. How do I know this? Because the statement, "Truth does not exist" is necessarily false since it does not agree with the fact (or the reality) of my existence.

If nothing else, for something to be true, it must agree with reality.

Moreover, when I consider other facts about reality:

The world is round (even if I believe it is flat)
2+2=4 (even if I can't add)

The planets in our solar system revolve around the sun (even if I don't exist)

several things about the nature of truth emerge. Namely:

Truth is independent of belief
Truth is universal (2+2=4 is the same for everyone)
Truth exists even if I do not

Additionally, there's something else I've discovered about truth - it doesn't contradict itself. The claim, "There is no truth" will always be false because if it were true, the claim would be simultaneously false, and therefore, self-refuting.

Self-refuting statements are the most common error people make with logic.

Consider these additional truth claims that are self-refuting:

All truth is relative (except this statement which is absolutely true)
It's wrong to judge the moral beliefs and behaviors of others (except the moral judgment of this statement)
Only that which is testable by science can be true (despite the fact this statement is not testable by science)
I am lying now (which, if true, means I'm not lying)

These statements reveal that truth must be self-consistent.

So, summarizing what I know about truth:

1. It exists.
2. It must correspond to reality
3. Must be self-consistent

4. Independent of belief
5. Universal
6. Absolute
7. Discoverable
8. Understandable

Equipped with this knowledge about the nature of truth an belief structure can be erected to answer questions like:

1. Does my existence have an origin?

2. Does my existence have meaning?

3. Does my existence have purpose?

Answering these questions leads to broader questions such as:

1. Does the Universe have an origin?

2. Does the Universe have a purpose?

3. Does God exist and, if so, how can I know him and what role does he play in human affairs, if any?

As we seek these answers we form beliefs. Beliefs are important because they shape our behavior, attitudes, and perceptions - even our identities. In fact, I argue they are intrinsic to the human mind because nobody is born knowing everything (omniscience) and since we don't belong to a collective mental hive (think Borg), our minds have no choice but to form hypotheses and assumptions about our experiences in our environment. We simply can't help it! Our brains seem hard-wired for making inferences!

However, we should strive to develop a belief model that provides the most thorough explanation of the Universe based on the nature of truth as described above. Some aspects of this model will be based on certainty (like our self-existence) but the rest must be filled in by that which corresponds the closet to reality. In other words, the one which most throughly provides the answers to the questions I posed.

Thus, armed with the certainty of our existence and the knowledge of the nature of truth, it is indeed possible to erect a belief structure, a worldview, if you will, that is based not on blind faith, but on confident, cogent faith.

Scientific Integrity

2009-02-13T16:54:00.003-06:00

I disagree with Nobel Prize winner James Watson who said, "“Today, the theory of evolution is an accepted fact for everyone but a fundamentalist minority, whose objections are based not on reasoning but on doctrinaire adherence to religious principles.”

While I believe it is the duty of all scientifically educated people to promote and encourage the use of science as a valid means of investigating the natural universe. I also believe it is incumbent upon the same to remember the philosophical underpinnings of the scientific method.

Failure to do so will promote science as an ideology - scientism - which I vehemently oppose.

Scientific theories are ultimately based on an inductive interpretation of a data model obtained through experimentation, and therefore, not based on certitude. To promote any scientific theory as fact, in other words, absolute, is not only intellectually dishonest, and a misunderstanding of the nature of science, but, it serves to promote deceitful dogma.

To use an analogy from Calculus, science is like the limit of a function in that experiments produce theories that become increasingly close to truth, but never quite reach it.

Consider:
lim f(e) = T
e->i
where e=experiment, i=infinity, T=Truth.

Thus, the above equation states that as e approaches i (an infinite number of experiments ) theories become increasingly closer to Truth.

Or, restated, over time, as knowledge of the physical universe increases through continued experimentation. our confidence in theories will strengthen but, they should never be considered as absolute.

So, here's the bottom line, promote scientific discoveries, yes, but never forget the scientific method is not a static, rigid model to uncover natural absolutes, but, a fluid, dynamic method of reasoning for approaching Truth.

Dr. James Watson would do well to remember that in my humble, opinion. I much prefer the comment made by Francis Bacon, "A little science estranges a man from God, a lot of science brings him back."

The Argument from Consciousness

2009-01-16T07:56:00.002-06:00

I subscribe to an email newsletter that provides a daily vocabulary word with its meaning and usage. Monday's word was pneuma, a Greek word that means, breath, wind, or spirit. The word resonated with my recent research into the definition and origin of consciousness and lead me to formulate this initial effort into a metaphysical argument for God's existence (before anyone asks, yes, I've read the book, The Origin of Consciousness in the Breakdown of the Bicameral Mind by psychologist Julian Jaynes).

Regarding consciousness or, synonymously, self-awareness, science has no compelling theory for its origins. In fact, brain research technologies like Neuroimaging and brain scans, have recently been criticized for inflating correlations between emotions and brain regions, and, while the neocortex may be considered the seat of consciousness, yet, its physical and, even, quantum properties reveal no attribute of consciousness - not even a hint!

In other words, the biological collection of neurons, axons and dendrites that comprise our cognitive structures may provide the mechanisms for consciousness, but they don't produce it.

Yet, mainstream scientists would have us believe that consciousness, somehow, spontaneously arose through natural selection despite no compelling experimental evidence to support it. Hmmm. That smacks of faith, does it not?

And, here's another thing. Human beings are not only conscious and self-aware, we are aware that we are conscious and self-aware. We have a sense of self, an I, a me, Nothing discovered by science explains our self-identity, yet, we all have one. Even attempting to deny it leads to a self-contradiction.

The truth is this: it's not science that discovers and defines consciousness, it's consciousness that discovers and defines science!

So, if science can not explain the origin of consciousness, what does?

Since we're dealing in faith, here, I propose the origin of consciousness and, subsequently, self-awareness results from an energy force we refer to as spirit, or in the Greek - pneuma.

Consider the brain is much like a printed circuit board (or motherboard) in a personal computer. While it contains all the components and circuitry for complex operations, yet, without the flow of electrical energy - the invisible force that energizes and brings "life" to the motherboard - the entire personal computer is no more than a boat anchor; lifeless and devoid of life, incapable of a single operation.

So it is with our brains. Without spirits to energize and utilize the brains circuitry, we are incapable of a single, consciously aware act. The spirit provides the conscious energy that produces self-awareness and self-identity. That's why scientists will never create a self-aware machine. We may create machines that are intelligent, maybe more so than us, but they will never possess consciousness and self-awareness, they will never have self-identities because we, their creator, are incapable of manufacturing spirits.

Only God - the Ultimate Source of Conscious Energy - is able to fabricate, and manufacture new spirits.

The Old Testament book of Genesis puts it like this: God formed and manufactured humans from the natural elements of the Earth. In this, our bodies share with other animals a common natural source. It wasn't until God - the Source of Spirits - breathed/pneuma (Hebrew: nshamah) into humans that we received our spirits and became living souls (see addendum below).

In summary, there's no indication the complex, physical mechanisms that make up our brain can produce a personality like Martin Luther King Jr. or Mother Teresa. In fact, looking at it strictly from a natural perspective, it's seems foolhardy to do expect such. It's only when we allow the existence of a Spirit-Giver that consciousness and self-awareness make rational sense.

I invite your comments and rebuttals.

Addendum. The word soul is often used interchangeably with the word spirit. This hasn't always been the case. In ancient cultures, humans were considered to be composed of three distinct, but intimately connected parts: the physical (body), the soul (emotions, will and intellect) and spirit (life force).

Interestingly, demonic possession is the influence malevolent spirits exert on the soul and body, but not the spirit. This, however, is more properly the topic of another Filosophy Friday.

Fight Truth Decay!

2008-12-05T17:32:00.002-06:00

I fear our society is eroding morally and intellectually. Actions are motivated by beliefs and many of us are strongly committed to beliefs that simply don't make sense resulting in harmful actions and attitudes. If we are really serious in this country to stop hate crimes and prejudice, we must be willing to examine our beliefs and discard those that are irrational. We must learn skills to improve our reasoning and to weed out irrational beliefs that could, potentially harm us, our loved ones or others.

But there's a problem....

People rarely examine their beliefs. Beliefs color the way we view the world, form our self-images, deal with tragedies, determine our purpose, and provide the foundation for all our decisions. However, from my experience, people rarely examine their beliefs for reasonableness nor do they understand how and why they maintain their beliefs. Astonishingly, they will vehemently defend these ill-formed beliefs before validating them for reasonableness or corresponding them to reality.

Why? Because....

Humans are not hard-wired for rationality. The reason for this phenomenon lies in the nature of the brain structures in the frontal lobes whose function is to provide explanations regardless of their rationality. Despite the fact that everyone reasons - for it’s a function of the brain - humans are not naturally skilled in valid reasoning. Rather, humans are naturally reactive (consider road rage, for example), possessing adaptation skills necessary for survival and reproduction.

Change is hard because...

Humans reinforce the beliefs they possess. Since our minds are predisposed for survivability, and not rationality, it's easy to fall prey to self-deception. Regardless of their validity, we tend to reinforce the beliefs we have and resisting adopting new ones. As Demosthenes, a 4th century Greek philosopher said, "Nothing is easier than self-deceit. For what each man wishes, that he also believes to be true."

The desire for our wishing thinking to be true can be so strong we unconsciously cement it into our worldview without ever questioning their validity. In short, we will deceive ourselves into believing our desires ARE true. Ironically, it seems our strongest beliefs, the ones we vehemently defend, are those we never question.

Thus, we drift away from truth rather than closer to it, unless we realize...

The introspective application of logic increases rationality and mitigates truth decay. Truth should be our goal - not lies, nonsense and deceptions. Self-deception erodes and decays Truth rather than seeking to preserve it. It leads to racism, bigotry and intolerance. Truth equips us to live life on life's terms, and logic, when properly applied, preserves and increases Truth. Thus, by critically examining and discarding irrational beliefs one mitigates self-deceptions, values others, increases their survivability and moves closer to Truth.

Lack of an introspective application of logic is the reason that otherwise, smart, intelligent people maintain unreasonable beliefs.

What can you do to prevent truth decay?

First, equip yourself. Devote 30 minutes a day learn logic. Arise from bed a half hour early, if necessary - it's well worth it. Find tutorials on the Internet. Better yet, take an online course from an online University or purchase a professionally lead video course.

Second. Apply your skills. As your critical thinking skills grow, identify fallacies in advertisements, radio broadcasts, and the media. I guarantee you'll be amazed at the amount of deception present in your society. Also, work logic puzzles found on the Internet and in magazines.

Third. Validate your beliefs. After becoming skilled in identifying incorrect reasoning, apply your new critical thinking skills to yourself to identify unreasonable and invalid beliefs. Question the source of your beliefs. Become willing to change even your most cherished beliefs. Justify your conclusions and guard against assumptions. Every belief should be examined and justified before it is allowed into your worldview. Don't accept a belief just because you were told to believe it by an authority. Discover for yourself if it has merit. And, certainly, don't accept a belief because its reflects your wishful thinking. That leads to self-deception, guaranteed.

Fourth: Teach. Teach your children well. Make it a game. Tell them a story containing irrational reasoning and offer points for identifying the invalid logic. Play logic games and puzzles with them. Make it a family affair. Make it fun!

Fifth. Become a truth evangelist and join me to encourage others to fight truth decay! Those who are enlightened have a duty to enlighten others and raise everyone's consciousness. Use your powers for good!

Addendum: As an exercise in the sort of illogic encountered in daily life, consider the following statement: all religions lead to God (Religious Relativism). What's wrong with that statement?

It means well, but the problem appears when one reviews the fundamental doctrines of the world's religions which contradict each other. One or more religions would need to discard or compromises fundamental doctrine they believe leads to God. Try reconciling Christianity and, say, Paganism without compromising the doctrine and traditions or one or both. It can't be done.

So, logically, all religions can be wrong, or, one or more of them can be correct, but ALL of them can't be correct since a logical contradiction would result. This is how truth decay begins. Don't be duped by sincere people with good intentions. A deception is still a deception regardless of its sincerity.

Can scientists and intelligent people believe in God?

2008-12-02T22:04:00.003-06:00

Recently, an Internet newsgroup posed the questions, "Can a scientist believe in God and, more generally, "Is a high IQ compatible with religious belief?" While the many in the newsgroup believed science and high intelligence are not compatible with a belief in God, Stephen M. Barr believes the answer to both questions is a resounding yes!

Barr is a particle physicist and professor at Bartol Research Institute, University of Delaware, who specializes in unified field theory, CP violation theories, quark and lepton origins, extra space-time dimensions, and the interface between particle physics and cosmology.

Barr has written an intriguing book entitled, Modern Physics and Ancient Faith in which he proposes that modern physics requires an Observer to actualize the Universe into existence.

How?

The equations in modern physics yield probabilities. Ultimately, probabilities must be actualized to have meaning. As a crude example, the result of a coin toss is 50% heads or tails. Even though the probability of ten heads appearing in, say, twenty tosses can be computed, until someone actually observes the outcome, the result of the coin toss is never actualized - it remains only a possibility.

Similarly, quantum equations can make predictions about particle energy states, but until an observer (a scientist) makes a measurement, atoms, electrons and their constituents exist as as mists or clouds of possibilities simultaneously existing everywhere. Scientists refer to the cloud of possibilities as quantum superposition and the act of actualizing a specific result from the cloud of possibilities as quantum decoherence.

Barr seems to propose the Universe actualized from the result on an initial immaterial Mind.

Perhaps, after reading Barr's book, I'll use the word Observer as the originating quantum decoherent agent that untangled the initial quantum states to produce the macroscopic Universe .

Given Barr's credentials and obvious profession, the answer to the first question is, "Duh. Of course a scientist can believe in God."

But what about the claim that high IQs are incompatible with religious belief? To put it nicely, poppycock!

Dr. Francis Collins the intellectually gifted director of the National Human Genome Research Institute not only believes in God, he is a Christian!

In fact, Collins has also written a book, The Language of God: A Scientist Presents Evidence for Belief in which he describes his journey from atheist to Christianity. In it, he writes, "...the experience of sequencing the human genome, and uncovering this most remarkable of all texts, was both a stunning scientific achievement and an occasion of worship."

Moreover in an interview with Belief.Net, Collins explains that God is not threatened by our scientific adventures nor is science threatened by God, but, rather, it is enhanced.

Look, we all need to be intellectually honest and admit that belief in God is not the result of blind faith, lack of evidence, or low intelligence and the characterizations of believers given by newsgroup posters, Dawkins, Hitchens and others of their ilk are simply hyperbolic caricatures. Even Richard Feynman, in my mind, one of humanity's greatest scientists, said, "many scientists do believe in both science and God, in a perfectly consistent way"

Belief in God boils down to a choice and for many, intelligent, rational people, belief in God is not only cogent, it is the most rational choice.

The Contradictory Nature of Natural Selection

2008-09-22T20:44:00.004-05:00

The philosophy of naturalism and natural selection essentially assert the survival of a species depends on the successful reproduction of organisms that are best suited to their environment. Throughout their academic careers students of science have had this definition drilled into their heads. Rarely, however, do people pause and consider the implications of natural selection. Why? Because, I believe, analytical reasoning is not formerly taught in most degree programs unless one is a philosophy major.

For example, consider natural selection. If true, then our cognitive faculties are the product of evolutionary processes that produce beliefs that help us survive. In other words, our cognitive abilities are selected for their survival value NOT for their truth detecting value.

Therefore, the beliefs we as a species possess have been selected for survival - not for truth!

Here’s the problem: if our cognitive faculties are selected for their survival value, rather than their truth value, then our beliefs about naturalism and natural selection are undermined because they are not the product of truth detecting mechanisms.

Therefore, naturalism, and by extension, natural selection are impossible to affirm. Moreover, our conclusions and assumptions about science and detecting reality must also be suspect since they too were formed using minds selected for survival and not for truth. Thus, the naturalist finds himself in a self-defeating vicious circle.

Even Darwin struggled with this conundrum. “With me, the horrid doubt always arises whether the convictions of man's mind, which has been developed from the mind of the lower animals, are of any value or at all trustworthy. Would any one trust in the convictions of a monkey's mind, if there are any convictions in such a mind?" (Life and Letters 1:315-16).

For the intellectual honest, the bottom line is that naturalism and natural selection, as they are promoted today, are not confirmable. For intellectual integrity, naturalists must doubt the truth value of their own system and admit something other than natural selection made us what we are – beings with minds capable of detecting truth.

Otherwise, naturalists are no different from the religious zealot types they like to characterize as low-brow neanderthals who maintain beliefs unsupported by anything other than the strength of their own will.

Laws of Thought

2008-05-23T00:00:00.001-05:00

Logic is the tool of philosophy which forms the foundational assumptions for the scientific method. These assumptions form the “laws of thought" that are essential to science and intuitively known by everyone. They are:

1. Law of identity: An object can not have two identities; a tree is not a telephone pole, a dog is not a cat.

2. Law of non-contradiction: A premise can not be both true and false at the same time.

3. Law of excluded middle: Something is or it is not; God either exists or he does not.

I am a Christian, not because someone told me it was true, but because it is a rational system that describes reality. For a system to be rational, it needs to be coherent. Christianity is certainly coherent even if it's premises are disputed. It offers a consistent description of why the Universe exists, its purpose and destinty.

For proof, I offer not only that which can be empirically validated (using the scientific method), but also that which can be logically inferred (using inductive and deductive reasoning) beyond a reasonable doubt. And, while I don't require a belief to be absolutely certain in order to accept it, still, it must be very close. In order for my faith to develop, it must do so on the rock of rationality.

For example, I may not be absolutely certain about my fate after death, but I am so confident (98%) in my belief in the afterlife that the difference is negligible and faith fills in the rest.

And, proof for me is not so much the positive affirmation of a belief but also how it stands up to negative attacks. Or, put another way, my beliefs are not formed by merely finding positive support for them - that's usually very easy - but, they must also withstand attacks to destroy them. In fact, my experience is that beliefs are made stronger by attempts to refute them (or discarded if they fail to measure up).

In the final analysis, when choosing between competing beliefs, the one that offers the most complete description of reality is most often the one that is more reasonable to believe. It is extremely important to understand there are meaningful aspects of the human experience and significant questions that science is not equipped to directly answer. Therefore, one must look to logic to validate or reject a potential belief.

So, the proofs that convinced me of the rationality for God's existence are not solely based on empirical evidence, but also on logical reasoning based on the “laws of thought.”

What is Logic?

2008-05-22T23:59:00.002-05:00

Logic is the study of the methods and principles used to distinguish correct reasoning from incorrect reasoning. Author of several books on logic and mathematics, Irving M. Copi wrote, "The distinction between correct and incorrect reasoning is the central problem with which logic deals."

Put more simply, logic is the science of reasoning.

What is reasoning? Reasoning can be defined as a type of thinking in which an inference occurs.

What is an inference? An inference is the process of drawing a conclusion from a one or more propositions which are either true or false.

What is a proposition? A proposition is merely a sentence that is either true or false.

Propositions are grouped to form arguments. An argument is a group of propositions, one leading to the next, that results in a conclusion.

Arguments, then, are structured forms of reasoning.

Arguments can be deductive or inductive. In a deductive argument, the conclusion necessarily follows from the propositions. For example:

All humans are mortal.
Socrates is a human.
Therefore, Socrates is mortal.

Deductive arguments are evaluted as either valid or invalid. This is important to understand because deductive argument can be valid but untrue. For example:

All humans have 3 legs.
Roy is a human.
Therefore, Roy has 3 legs.

The argument above has a valid form but its untrue premises render it invalid.

An inductive argument proceeds from specific observations to a general conclusion. For example:

All cows are mammals and have lungs.
All dogs are mammals and have lungs.
All cats are mammals and have lungs.
Therefore, all mammals (probably) have lungs.

Unlike the deductive argument, in an inductive argument, the propositions provide support for the conclusion, but the conclusion doesn't necessarily follow. Inductive arguments are evaluted as better or worse based on the strength of their propositions.

So, in conjunction with the Laws of Thought, the task of the logician is to:
1. Identify the form of the argument
2. Determine the validity of the deductive argument
3. Evaluate the strength of an inductive argument.

References:
Irving M. Copi, Introduction to Logic, 7th ed. (New York: Macmillan, 1986)
Geisler, Norman L., and Frank Turek, I Don't Have Enough Faith to be an Atheist, Crossway Books, 1300 Crescent St., Wheaton IL 60187, ©2004.

The Cosmological Argument - Part 1

2008-05-21T23:59:00.000-05:00

In order to keep these posts small and intellectually digestible I'm going to present the argument and the proof for its first proposition in this post and follow-up with the proof for the subsequent proposition in a later post. This approach will also help to keep the comments tightly focused.

The first argument is called the Cosmological Argument. There are several forms to this argument, but I will offer two of them. The first is has the following form:

Proposition 1: Everything that begins to exist has a cause.
Proposition 2: The universe began to exist.
Conclusion: Therefore, the universe had a cause.

Since argument is deductive, if I can prove both propositions to be true, then the conclusion necessarily follows. To render it invalid, only one of its propositions needs to be falsified.

Proposition 1 is supported by one of the strongest and universally maintained laws in existence; the Law of Causality. It's been expressed in various ways, but simply put it means that for every effect, there is a cause.

Without the Law of Causality, science would nearly be impossible since scientists seek causes in their experiments. Moreover, the law is universal because, while the law can't be proven, everyone intuitively understands that events have causes.

In fact, it's hard to imagine life any other way. Medical doctors search for the causes of diseases; lawyers seek to determine motives (cause) for a crime; software developers seek the causes of misbehaving programs.

But, perhaps most compelling of all, even denying the law proves it truthfulness because one can not deny the law without using the law in the process. For example, if someone were to say, "I deny the Law of Causality", simply ask, "What caused you to draw that conclusion?"

Therefore, since the Law of Causality is unquestionably accepted to be true, the first proposition of the Commological Argument has been proven to be true.

The Cosmological Argument - Part 2

2008-05-21T23:58:00.000-05:00

I'm cutting to the chase, as the saying goes, and get right to the point. The comments are available for questions and feedback.

Einstein's General Relativity predicted a expanding universe that has been verified by the Big Bang Theory which postulates the Universe had a beginning. Scientists may argue over the details, but, ultimately, long ago, before time 0, there was no Universe, then suddenly, it sprang into existence.

Some thing caused the event or events that resulted in the Universe - the Universe did not appear on it's own and there's no definitive reason to believe that it did. Moreoever, in 1965 scientists Arno Penzias and Robert Wilson discovered cosmic background radiation from the initial Big Bang explosion that confirmed its occurrence. They won a Nobel Prize for their discovery.

Next, in 1989, the NASA Satellite COBE (Cosmic Background Explorer) detected primordial "Galactic Seeds" that formed the galaxies of the Universe. From these seeds, the Universe was formed and structured.

Either the Universe began to exist or it has always existed. The evidence provided by Galactic Seeds, the Big Bang, and the Laws of Thermodynamics more than prove the Universe had a beginning.

Are they absolute proof? No, but certainly, they are more experimentally verfiable than the alternative that the Universe had no beginning.

Thus, the weight of the evidence establishes the truth of my second proposition. Since both premises have been shown to be verificably true, it is certainly reasonable to believe the Universe was caused by some thing.

What was that some thing? In the next post, I'll connect that thing with God.

see:
Big Bang Theory
COBE
Galactic Seeds

An Layman's Primer on Thermodynamics

2008-05-21T23:57:00.000-05:00

To setup the proof for the second proposition, a brief explanation of three foundational precepts to the study of Cosmology is necessary. These precepts are known as Thermodynamics, or the Laws of Energy, Einstein's General Theory of Relativity, which describes gravity, and a model of the Universe predicted by General Relativity known as the "Big Bang."

These scientific laws and theories will provide the proof for the second proposition of the Cosmological Argument.

We can all agree, I hope, that the Universe is filled with energy. Scientists recognize several forms of energy. Some of the more familiar forms are: chemical, nuclear, electrical, and mechanical. Still, regardless of its form, energy is transfered though heat flow, i.e., when heat is transfered from a warmer place to a cooler place.

Why? Because differences in temperature causes heat to flow. The bigger the difference in temperature, the faster heat flows until a uniform temperature is achieved. When temperatures are the same there is no heat flow and, thus, no change in energy.

The study of energy and its characteristics is described by the science and mathematics of Thermodynamics which posits four "laws". Everything scientists know about the operation of the entire Universe, even at the smallest subatomic level, is described by the flow of energy because nothing occurs without an exchange, or transfer, of energy.

Even at the beginning of the Universe, before time began, energy transfers occurred. One might even say the Universe is the result of, and continues to be, the transfer of energy. That's why some scientists consider Thermodynamics to be the ultimate science.

Through experimentation, scientists can mathematically describe 4 laws that govern energy transfer.

The zero law, so named becaused it was discovered after the first law, states there is no heat flow between objects that are the same temperature. We see this in the operation of thermometers. The temperature of a thermometer stops rising when it reaches the temperature of the object under measurement.

Therefore, energy, as heat, flows from a higher temperature to a lower temperature.

The next law, the first law, states that energy can not be created or destroyed; it can only be transfered from one form to another. Thus, in any closed system, (like the Universe!!), the amount of energy is constant.

The second law describes the distribution of energy. When energy (or heat) is transfered, it becomes more dispersed, less organized. An unlit candle, for example, contains potential energy that is organized in one place - the candle. When lit, the energy from the candle is released in the form of heat and moves from a hot place - the candle - to a cooler place - the air. After the candle has been extinguished, the amount of energy once tightly organized in the candle as potential energy, has been dispersed into the air.

No new energy has been created or destroyed in the burning of the candle. Rather, the amount of energy contained in the candle medium has been transfered into another medium, the air.

Scientists describe the tendency of energy to become more disorganized as "entropy." The second law states that entropy always increases in a closed systems (like the Universe!!!) and, because the amount of energy is constant (first law), the exact distribution of energy can be calculated.

Theoretically, it's possible for energy in a closed system to remain the same or even be reversed (energy flowing from cooler to hotter) if the temperature of a system is reduced to absolute zero (–273.15 degreess) where all molecular motion ceases.

However, this is practically impossible to achieve as stated by the third law. If it were possible, for entropy to be reversed, cause and effect would be reversed and we'd experience really strange things, like time flowing backwards; broken objects reassembling themselves and cold objects becoming increasingly hotter.

In summary, the Laws regarding energy are:

1. Energy (heat) flows from hotter place to cooler place.
2. There is a fixed amount of energy in the universe.
3. Energy always moves from a state of organization to state of uniform, but disorganized distribution (entropy).
4. There is no known natural way to reverse entropy.

Because of these laws, it is far more reasonable, in my opinion, to believe that cause and effect has always occurred because some cause must have initiated a transfer of energy to cause the Universe to explode into existence. That's why I maintain that - even at 10 to the minus 43 seconds of the Universe's existence - cause and effect still appy.

Moreover, the law of cause and effect will continue until the Universe no longer exists. According to astrophysicists Fred Adams and Gregory Laughlin, unless some inconceivable event that launched the original Big Bang should recur, the universe will eventually decay, leaving a featureless, infinitely large void.

See the following links for additonal information:

What is Thermodynamics
Answers.com
The Engineering Toolbox
Physics4Kids
The Future of the Universe

God as First Cause

2008-05-21T23:55:00.000-05:00

Establishing God as the instigator of the Big Bang, and thus, the Universe, requires an inductive approach. The evidence may indicate the Universe had a beginning but not what caused it. And, positing God as the instigator must also address his origin.

In other words, what caused God?

The bottom line is that a thing that exists either:

a. had a beginning and is caused, or
b. has always existed and is uncaused

The inductive approach starts with the conclusion from the Cosmological argument that the Universe had a beginning. However, the cause of the Universe can not be another thing that had a beginning because that would lead to an infinite number of causes.

Therefore, reason requires a First Cause that is uncreated and eternal (exists outside of time). Keep in mind that the Cosmological argument doesn't state “every thing that exists has a cause”, but rather, "everything that begins to exist has a cause”.

Since the First Cause never began to exist, it does not require a cause. Thus, no one created the First Cause - it has always existed. This means the First Cause is:

1. self-existent
2. exists outside of time
3. inconceivably powerful to birth the Universe

Since, these qualities are the same qualities theists attribute to God, therefore, the First Cause is God.

The Leibniz Cosmological Argument

2008-05-21T22:11:00.000-05:00

Gottfried Leibniz, philospher, scientist, mathematician and all round genius asked, "Why is there something rather than nothing?"

Think about it. If nothing existed, then no answer is required because nothing needs no explanation. But, if something does exist, then some explanation of why it exists is needed.

In response, Leibniz developed a logical principal called the Principle of Sufficient Reason (PSR) which states that all things have an explanation or cause for their existence.

Thus:
For every entity x, if x exists, then there is a sufficient explanation why x exists.
For every event e, if e occurs, then there is a sufficient explanation why e occurs.
For every proposition p, if p is true, then there is a sufficient explanation why p is true.

Using the PSR, Leibniz posited the following argument for the existence of God:

1. Every existing thing has an explanation of its existence, either in the necessity of its own nature or in an external cause.
2. If the universe has an explanation of its existence, that explanation is God.
3. The universe is an existing thing.
4. Therefore the explanation of the universe is God.

Since the universe clearly exists, there must be reason for its existence. Self-causation to explain the Universe's existence is unsupported by the evidence of the Cosmological argument. The cause for the universe, then, must be something other than the universe itself - something external to it.

When used in conjunction with the Comological Argument, Leibniz's argument provides good reason to believe that God is the best explanation for the origin of the Universe.

The Anthropic Principle: Evidence from the Big Bang

2008-05-19T19:35:00.000-05:00

Another strong argument for the existence of God is known as the Anthropic Principle which argues the fundamental constants observed in the Universe are finely-tuned to allow the Universe and life as we know it to exist.

Dr. William Lane Craig puts it this way:

1. The fine-tuning of the universe is due to either physical necessity, chance, or design.
2. It is not due to physical necessity or chance.
3. Therefore, it is due to design.

Since the evidence for this argument is so numerous and powerful, I'll present each in a separate post. In fact, Antony Flew, former champion of atheistic philosophy, was convinced by these arguments (see comments).

Consider:

If the Big Bang was slightly too weak, the expanding matter would have collapsed back in on itself preventing the formation or stars and planets - much less planets suitable for life. The density of the Universe necessary to prevent a recollapse of the Universe is known as critical density.

On the other hand, if the enregy of the Big Bang was slightly too strong, the expanding volume of space would have been to fast preventing the formation of stars and planets.

Thus, the expanding matter from the energy of the Big Bang compared to the expanding volume of space must have been extremely balanced or the Universe would not have formed at all. Physicist John Polkinghorne determined this extremely fine balance must have been within one in 10^60 - equivalent to hitting an inch-wide target at the farthest reaches of the observable universe from Earth.

From this, it seems far more reasonable to believe this balance was achieved not by chance, but by intent (design).

The Anthropic Principle: Evidence from Gravity

2008-05-18T15:48:00.000-05:00

Consider gravity. Gravity is one of the four fundamental forces of the Standard Model of Physics. What is the nature of gravity? Is it caused by the mass of an astrological object bending spacetime as General Relativity claims? Or is it a theoretical particle having no mass and no charge that carries a gravitational force as Quantum Physics suggests?

Currently, the only theory experimentally verified is the model proposed by General Relativity. Physicists would very much like to unify General Relativity and Quantum Theory, but as of today, this has not been accomplished.

What we do know about gravity is that if it were too strong, stars would burn too quickly and collapse under their own weight. Additionally, Black Holes would form too often and, essentially, devour all the matter of the Universe before life could form.

On the other hand, if gravity were too weak, the stars would not have compacted enough to the to produce nuclear fusion. Without fusion, heavier elements (such as carbon!!!) would not have formed preventing life as we know it from forming.

The fact that we exists proves that gravity is tuned just right to support life. The question that begs an answer is why does gravity seem so finely tuned to support the existence of a Universe capable of sustaining life?

The anwers seem to boil down to three:

1. The existence of an infinite number of physically real universes (a “multiverse”, if you please) guarantees that at least one of them will support life.

2. A designer hypothesis that created the Universe for life.

3. Pure coincidence. The fine tuning of gravity is in appearance only and implies nothing.

Number 3 can be immediately rejected, I think, because leaving fine-tuning unexplained leads to the acceptance of complicated, inelegant theories without good reason to do so. If a more elegant theory can account for the available data, then it is to be preferred as the more reasonable theory. I am, after all, appealing to reason from the available experimental data.

The problem with number 2 is that the existence of multiple Universes has not been empirically verified. Sure, proponents point to the inflation of the Universe and a non-zero Cosmological Constant, but at best, these provide the foundation for speculation - not hard evidence.

That puts miltiverse supporters on very shaky ground. Moreover, since the theory hasn't been verified, multiverse proponents are actually in a weaker position than their Intelligent Design opponents (although I don't think the existence of multiverse reality prevents the existence of a Designer).

Intelligent Designers, at the very least, have the weight of emperical evidence to support their reasoning and why I believe number 2 offers the most reasonable case. Multiverse proponents have no hard evidence to support their theory. Until they do, it is not incorrect to suggest the multiverse theory be regarded as metaphysical, and therefore, unfalsifiable.

The Anthropic Principle: Evidence from the Strong Nuclear Force

2008-05-17T15:19:00.000-05:00

When two like poles of a magnet are brought together, they repel each other. In a similar way, a force known as the Coulomb Force repels the positively charged protons within the nucleus of an atom.

What keeps the protons from flying apart?

A stronger force called the Strong Nuclear Force (SNF). The SNF overcomes the Coulomb Force and binds together positively charged protons and neutrally charged neutrons.

If the SNF were slightly weaker, perhaps a little as 2% weaker, the protons would repel each other due to the Coulomb force leaving behind a single, lone proton for the nucleus. Thus, the entire Universe would consist solely of the element hydrogen which has but one proton.

Conversely, if the SNF were slightly stronger, just 0.3% stronger, only elements with more than one proton would exist, thus preventing hydrogen from forming. Since hydrogen is key to life sustaining molecules (like water!), life could not form.

In both cases, life as we know it, would not, could not exist!

Since the SNF must fall within a very precise range for life to exist, it is far more reasonable to postulate a designer established the finely tuned SNF than to believe in random chance. The odds are just too great for random chance to explain.

The Anthropic Principle: Evidence from the Weak Nuclear Force

2008-05-16T16:14:00.000-05:00

An atom's atomic count is determined by the number of positively charged protons present in its nucleus. But an atom's nucleus also has neutrally charged particles called neutrons. Together, the protons and neutrons determine the atom's mass number.

It's been posited that the only significant elements produced in the Big Bang were hydrogen (atomic count: 1) and helium (atomic count:2). If true, what is the source of all the other elements?

The answer is explained by the presence of a force called the Weak Nuclear Force (WNF). The WNF is so named because it is 1o million times weaker than the Strong Nuclear Force. However, the WNF is not insignificant to the nucleus of an atom.

The WNF controls the rate of the transformation of protons into neutrons by a process called beta decay (specifically, beta minus decay)

If the WNF were slightly stronger, lighter elements with smaller atomic numbers would decay into heavier elements (with larger atomic numbers) more quickly because their neutrons would be transformed into protons. This would prevent simple, life sustaining molecules (like water!!!) from forming.

If the WNF were slightly weaker, there would be an abundance of lighter elements in the Universe (hydrogren and helium), but, little, if any, of the life forming heavier elements - like oxygen, nitrogen and carbon!

Therefore, the WNF must be tuned just right so life as we know it can form. Which is more rational to believe based solely on the scientific data...random chance tuning or tuning by an intelligent designer?

Clearly, the evidence is weighted for the intelligent designer.

The Anthropic Principle: Evidence from the Electromagnetic Force

2008-05-15T20:20:00.000-05:00

Previous posts described the strong and weak nuclear forces that operate on the nucleus of an atom. But, in addition to the nucleus, an atom is comprised of tiny, negatively charged particles called electrons.

Electrons are very peculiar. In one sense, they behave like tiny particles with position and momentum, but at the same time, they have properties similar to an ocean wave. And, because they are so tiny and have virtually no mass, their exact location around the nucleus can not be precisely determined. The best we can do is calculate their probable locations.

So, it's more accurate to say that electrons surround the nucleus of an atom, much like a dense fog bank surrounds, say, a house.

Thus, an electron cloud, coined by one of my favorite physicists, Richard Feynman, represents the locations where electrons are most likely to be.

Now, here's an interesting question: what binds the electrons to the nucleus and prevents them from all flying off into space?

The answer is the electromagnetic force (EF). Not only does the EF bind the electrons to the nucleus to form atoms, but the EF also makes it possible for atoms to bond to other atoms to form molecules. In fact, the EF is responsible for all electrical and magnetic interactions in the Universe including light and color.

Now, here's the thing. If the EF were a little stronger, electrons would adhere to atoms so tightly that atoms would not share their electrons with each other preventing chemical bonding and the formation of live sustaining molecules (like water, hello!).

However, if the EF were a little weaker, electrons would not bind to the nucleus preventing the formation of atoms and life forming compounds like nucleic acids and proteins (yikes!).

Therefore, the EF must be finely and precisely tuned or the Cosmos as we know would not have formed, much less sustain life.

Together, with (1)gravity and the (2)strong and (3)weak forces, the EF make up the four fundamental forces from which all other forces in the Cosmos, ultimately, derive and provide powerful evidence for the existence of a Tuner. Their precise tuning is best explained not by randomness, but by an intentional Designer.

The Impossibility of the Infinite

2008-05-14T20:28:00.000-05:00

Despite claims by well-meaning scientists, the Universe must have had a beginning. This is not only supported by the current testable data, but also for the following logical reasons.

p1: An actually infinite number of things can not exist because an infinite number of things can not be traversed.
P2: An infinite universe would require an actually infinite number of days to have been traversed to arrive at today. Thus, today would never arrive.
p3: However, since today has arrived, an infinite number of days has not been traversed.

Therefore, an infinite universe can not exist.

Theoretically, the concept of infinity is interesting, but to actualize the concept in the real world leads to absurd results. Consider the absurdity of an infinite number of actual books. Where would a new book be added? Where would a new book be removed? Remember, there's no beginning or end. Yet, in both cases, removing or adding a book would not change the quantity - the number of books would remain infinite.

For a more thorough treatment of this argument, see Dr. William Lane Craig's article that describes the absurdity of an actual number of things using David Hilbert's paradox of the Grand Hotel.

The Chirality Argument

2008-05-13T22:20:00.000-05:00

Chirality is a term used in geometry to describe the asymmetric properties of geometric figures. Put more practically, look in a mirror. The reflected image is said to be chiral because it is the reverse image of your physical characteristics.

Even better, look at your hands. Each is an asymmetric image of the other and thus chiral. Moreover, they are said to be non-superimposable meaning one can not be superimposed over the other. For example, the fingers of a left handed glove are non-superimposable with the right hand.

Chirality is also important to science. Virtually all molecules necessary for life exist in two non-superimposable forms. In other words, they are mirror images of each other and related like our left and right hands and like our hands, they are non-superimposable with their mirror images.

In theory, chemical reactions should combine amino acids and sugars to produce equal amounts of right and left hand images of molecules essential to life, but this is not the case at all - at least on Earth where right hand sugars combine almost exclusively with left hand amino acids.

This is important because molecules of the wrong handedness would be indigestible by our digestive systems. The food we enjoy would be poison to us - goodbye steak and baked potatoes! Life, then, depends on a specific molecular handedness.

Scientists don't know the why the Earth prefers a specific molecular right-handedness. Like everything they don't yet understand, scientists assume random chance. Ok, maybe that was a bit of a cheap shot, still, it's frustrating that well-educated, smart scientists are so closed minded and wooden in their biases. Take Biochemist David Dreamer who says the following regarding life's right-handedness, "The most plausible idea is that it was an accident."

As the English say, "Riggght".

The showstopper for evolution is that complex life would not have formed at all in an environment that is chirally opposed to it. Why? Because DNA would not stabilize and store hereditary information in its double helix if even a single wrong-handed monomer were present.

What are the chances that a specific handedness would have been randomly produced? Can anyone say with any precision? The answer is no!

The following theories have been proposed to explain the right-handedness of Earth life - all are weak and closer to speculation than verified by repeatable experimentation:

Circularly polarized ultraviolet light
Beta decay and the weak force
Optically active quartz powders
Clay Minerals
Fluke seeding
Magnetic fields

Part of the problem is finding a suitable environment for scientific study. Martin Quack, a physical chemist at the Swiss Federal Institute of Technology in Zurich says, "It's almost impossible to find a chirally neutral environment on Earth because life's chiral excesses infect everything."

Therefore, since the chemical compounds needed to sustain life depend on a environment with a specific chirally handedness and the theories to explain the origins of the handedness are so weak...why do so many people state that macro-evolution is a "fact"?

I don't get it. Since when did an "accident" become a plausible, testable hypothesis? It's far more plausible to me to believe an intelligent force designed and created an environment with a specific chirally handedness so life would form and thrive than to assume it was by accident.

The Goal-Driven Argument

2008-05-12T21:04:00.000-05:00

In the creationist-evolutionist debate, often overlooked is the argument that living matter possesses an inherent goal oriented nature that is not present in the non-living matter that preceded it. As Antony Flew asks in his book, There is a God, "How can a universe of mindless matter produce beings with intrinsic ends, self-replication capabilities, and 'coded chemistry'?"

The absence of a satisfying answer from evolutionists poses a significant problem and one that must be answered by any origin of life theroem.

All living matter strives to reproduce. The fatal blow thus far to mainstream evolution is the failure to adequately demonstrate the means by which reproduction arose, naturally, from non-reproducing matter.

How did self-directed, reproductive purposes emerge from inert matter? Biologists have no answers, yet, in no other area would the absence of such a fundamental and necessary requisite be tolerated. Why is it tolerated for evolution?

In the absence of a natural explanation, its reasonable to assert that living matter could not have emerged from non-living matter.

What makes more sense? Goal-oriented, purpose-driven life emerging from an intelligently guided source or from inert matter which has no potential for producing goal oriented purposes?

In summary:

P1. Goal oriented behavior is an inherent attribute of all living matter.

P2. Inert matter does not live, is not goal-driven and possess no capability to produce goal oriented behavior.

Therefore, living matter could not have originated from inert matter.

A Very Short and Simple Genetics Primer

2008-05-11T19:57:00.000-05:00

Perhaps, the strongest evidence for the existence of God originates in our genetics. This area of research presents a conundrum for atheists and skeptics. Why? Because there is not a single, repeatable experiment that comes close to demonstrating the origin of cells, chromosomes, genes and DNA. Yet, this is precisely the area of research, in my opinion, where natural theories must prove fruitful in order to be taken seriously.

It's one thing to assert that similar, physical structures imply a common ancestor, but, it's quite another to assert it at the cellular level.

For these reasons and others, the next series of arguments will make the case that belief in God as the originator of life is far more rational than the alternatives. To prepare for these arguments, a genetics primer is necessary to establish a foundation to build on.

Cells are the building blocks of life. They form colonies, they grow, and they reproduce. The human body is composed of approximately 200 different types of specialized cells like brain cells, skin cells, liver cells, and stomach cells. All total, they number around 100 trillion!

Regardless of their type, all cells share common traits:

They have an outer protective membrane that surrounds and protects the cell's interior and which regulates the intake and outake of nutrients and waste products.
The interior of all cells is filled with a watery substance called cytoplasm which contains the nutrients and machinery that carry on the functions of life.
All cells contain DNA, the instructions that direct the cell and orchestrate its replication. Without DNA, cells would not know how to carry on the functions of life or reproduce. Some cells have a nucleus in which the DNA resides. Other cells don't. In these cells, the DNA resides in the cytoplasm. Humans have both kinds of cells.

Bacteria are single celled organisms that have no nucleus.

DNA is composed of a chain of molecules that contain all the information necessary for the life functions of a cell. The individual molecules that make up DNA are called nucleotides. There are only four: Adenine (A), Thymidine (T), Guanine (G), and Cytosine (C).

A nucleotide is a molecule containing nitrogen.

The nucleotides bond together in pairs using specific rules. Adenine and Thymine always bond together and are represented as AT; Cystosine and Guanine always bond together and are represented as CG.

The resulting pairs are called "base pairs."

Why these rules - why not AC or GT pairs? Because the hydrogen bonds necessary for their pairing only exist with AT and GC.

To use the analogy of a sentence, the base pairs are grouped to form words, for example:
ATT CTG TAA.

The words form sentences:
ATT CGA CAC. ATG GAA TAA TCA TA.

The sentences are called genes.

DNA has two strands of sentences (genes) each complementing the other to form a unified whole. In other words, if one strand of the DNA sequence is ATTCGAC, then the complementary strand must be TAAGCTG.

A->T
T->A
T->A
C->G
G->C
A->T
C->G

Since they are complementary, the sequence of one strand determines the other.

The hydrogen bonds between the letters twist the two strands so that it looks like a twisted ladder called a double helix with the base pairs as the rungs, bonded to a sugar-phosphate backbone as the ladder frame.

The sentences inside the double helix are referred to as the genetic code.

The DNA double helix strand is partitioned into packages called chromosomes. Humans have 46 chromosomes. 44 of them are paired together because of their similarities and two, called the XY pair determine gender. Two X chromosomes (XX) specifies female and one X, one Y (XY) specify male.

Chromosomes are the basic units of heredity.

Chromosomes contain genes. Genes are short segments of DNA that instruct the cell to make proteins. How? Proteins are made of chains of amino acids and and genes provide the instructions for making the amino acid chains.

Proteins are the basic biochemical units that drive all biological processes.

In every cell, human beings have approximately 30,000-35,000 genes providing instructions for 100,000 proteins!

Incidentally, for awhile, scientists thought much of our DNA was 'junk' for which no function had been identified. Recent research, however, has been completely refuted their assertion. See below.

Regarding reproduction, cells reproduce by splitting. When this occurs, the DNA double helix splits breaking the hydrogen bonds between the base pairs. As the DNA strands unwind, new hydrogen bonds form on each single strand from the cytoplasm in the cell ultimately resulting in two identical, double helix strands, one for each cell.

So, in summary: Cells, the smallest unit of life, are fundamental to living systems and manage the biochemical processes of life. Some cells have a nucleus, and some don't, however, all receive their instructions from DNA which is segmented into chromosomes. When cells reproduce, they split forming identical cells with identical DNA strands.

The following links provide additional information:

What is a Cell?
A Tour of the Basics
DNA for Dummies
Junk DNA

The Problem of Life's Origins

2008-05-10T17:16:00.000-05:00

The origin of life poses a huge problem for mainstream scientists. When the origins of life are considered, the distinction between living organisms and non-living matter must be distinguished, and, once accomplished, the progression from non-living matter to living cells must be demonstrated.

Mainstream scientists posit living organisms spontaneously arose from non-living matter in a process called abiogenesis. However, abiogenesis has not been experimentally proven in any laboratory experiment and there exists many conflicting theories explaining the origins of life.

Because mainstream science has failed to produce a standard model for the origins of life, their assertion that life arose from non-life is a belief system much like religious belief systems. Evolutionary scientists have faith that, one day, experimentation will prove naturalism true.

In order to accomplish this feat experiments must clearly link, at the genetic level, non-living with living matter. Personally, I don't this will ever be done.

Part of the problem is the definition scientists have given for life, or specifically, living things. In the fourth edition of her text, Biology, Helena Curtis assigns 7 characteristics that distinguish living things from inanimate matter. These are:

Living things are highly organized and possess complex structures. Inanimate objects do not.
Living organisms are homeostatic meaning they remain internally consistent (temperature, chemistry, blood pressure etc.) despite their changing environment. This is untrue for inanimate matter. A fragile water flea, for example, maintains its internal chemical composition that differs from its constantly changing environment.
Living organisms reproduce...inanimate matter does not.
Living organisms grow and develop - a single living cell into a human being, for example. Inanimate matter does not grow and develop.
Living organisms convert energy from their environment into different forms of energy. Inanimate matter can not convert energy.
Living organisms respond to stimuli. Inanimate matter can't respond to any stimuli.
Living things adapt to their environment, inanimate does not.

All of these life-defining characteristics have their origin in DNA. It's at this level that mainstream scientists need to demonstrate, clearly, the transition from inert, lifeless, matter to living, reproducing cells. Until they do, abiogenesis can not be considered science.

Moreover, since evolution from one species to another has its foundation in abiogenesis, ultimately, evolution must be regarded as faith and not science.

In order to silence creationists, mainstream scientists must conclusively demonstrate through repeatable experimentation that life, at the DNA level, arose from inanimate matter that contains no DNA. Everything else is educated speculation, at best.

In the next few posts, I'll explore the various abiogenesis models as posited by mainstream scientists, show their inadequacies and why it's more reasonable to believe life arose from a creator.

The Problem of Complexity

2008-05-09T09:37:00.000-05:00

One of the most famous, and often referenced, experiments for the natural origin of life is known as the Miller-Urey Experiment. Essentially, Stanley Miller and Harold Urey attempted to recreate the chemical conditions they believed existed on the early Earth by generating a spark (simulating lightening) into a sealed array of glass tubes filled with methane, ammonia, and hydrogen (simulating the atmosphere) and water (simulating the ocean).

After a week or so, the scientists discovered several types of amino acids - the building blocks of proteins - including most of those needed for life. Additonally, sugars, lipids, and some of the other building blocks cells and nucleic acids were formed, however, DNA and RNA were not.

A few years later, John Oro discovered amino acids could be made from a solution of hydrogen cyanide, ammonia and water. His experiment also produced a large amount of adenine - a DNA base nucletoide.

Although proponents claim these and other experiments like them prove life originated on the early earth under natural conditions - without intelligence - in reality, the experiments provided compelling evidence for the opposite conclusion: that life is far too complex to evolve naturally.

For example, equal quantities of both right-and left-handed organic molecules (Chirlaity) were consistently produced by the Urey/Miller experient. In reality, nearly all amino acids found in left handed and almost carbohydrates are right handed.

If the handedness is incorrect, cells will not form because DNA will not stabilize and store hereditary information in its double helix.

Additonally, while scientists believe lightning storms were common on the early Earth, they were not continuous as the Miller/Urey experiment portrayed.

Thus, while amino acids and other organic compounds were formed, in the prebiotic Earth, they would not have been formed in the amounts produced by these experiments.

Scientist Paul Davies in a 1999 article in New Scientist sums it up nicely: "Making the building blocks of life is easy—amino acids have been found in meteorites and even in outer space. But just as bricks alone don’t make a house, so it takes more than a random collection of amino acids to make life. Like house bricks, the building blocks of life have to be assembled in a very specific and exceedingly elaborate way before they have the desired function." (Davies, Paul. 1999. Life force. New Scientist. 163(2204): 27–30.)

Next: The key to life is information.

The Problem of Mutations

2008-05-08T07:51:00.000-05:00

When it comes to explaining the origins and diversity of life, there is no room for God or any other supernatural explanation in mainstream science. Period. No, buts, no ifs, no exceptions.

As the late astronomer Carl Sagan said, "The cosmos is all that is or ever was or ever will be."

The implications of this naturalistic worldview are clear. One can not, with integrity, maintain a belief in the supernatural as a causal effect and at the same time embrace the scientific worldview. They are mutually exclusive.

Make no mistake. Mainstream science, as practiced today, is only and solely concerned with natural explanations. That's because scientific theories must be refutable and scientific experiments must be repeatable. Supernatural explanations, as of today, have not lead to refutable, repeatable theories.

Therefore, when it comes to explaining the origins of life, scientists restrict themselves to natural explanations. Even if the message "God was here" was found inscribed in a cell membrane, scientists would insist the origins of the message were natural.

One has to understand the strength of mainstream bias against supernatural explanations to understand the modern scientific worldview. I believe scientists today have willingly forced themselves into a logical corner from which there's no escape.

Consider that evolution teaches that over a span of millions of years, nonliving chemicals spontaneously gave rise to simple living cells that mutated into more advanced life forms resulting in all the variations of life that exist today.

Mutations are changes that occur in the DNA, specifically, to the order of the base pairs that form DNA.

Science describes two kinds of mutations in genes: those that alter amino acids and and those that do not. Recall that proteins are made of chains of amino acid chains and that genes provide the instructions for making the amino acid chains.

Mutations that do not alter amino acid chains are called silent mutations. These mutations don't affect genetic functionality and are considered evolutionary neutral.

Mutations that alter amino acid chains are either beneficial or harmful. Mainstream scientists argue that random, beneficial mutations, over a long span of time, changed the DNA of simple celled creatures which increased their survivability. These beneficial mutations were then passed to their descendants through inheritance leading to increasingly complex life forms.

In other words, without beneficial mutations, life would not have become increasingly more complex. Evolution, therefore, requires beneficial mutations because this is the only natural way, scientists argue, that new genetic variations, or alleles, are produced. Without alleles, everyone would look exactly the same.

The problem with this scenario is that mutations rarely result in a beneficial change that would increase the survivability of a population of simple cell creatures. It sounds good, but, experimentation doesn't justify the theory.

For mutations to occur at all, a cell, complete with DNA, must have formed first, somehow, someway. In my mind, the utter failure of mainstream science to offer a refutable theory with repeatable experiments that explains the or gins of cells and DNA undermines the theory's credibility.

Mainstream scientists simply assume, by faith, that an explanation is one day, forthcoming.

Nevertheless, for mutations to beneficial, a gain in new information within an organism’s genetic material is required. For example, for a population of amoebas, single celled creatures, to evolve into, say, fish, new information and new genetic segments would have to develop that would provide the basis for gills, scales, fins, etc. The DNA strand would increase as more functionality evolves.

But, experiments and research have overwhelmingly shown that mutations result in a loss of information, not a gain. Mutations are the reason we have diseases like cancer, mental retardation, cystic fibrosis and sickle cell anemia.

Granted, there have been a few cases of beneficial mutations when information was gained, However, for evolution to be true, billions of beneficial mutations are required. The fact is, beneficial mutations of this magnitude have not been observed in nature. Instead, we observe the opposite: organisms losing information. How can a loss add up to a gain?

The notion that random, beneficial mutations occurred for millions of years is simply not a viable scientific theory, at this time, because the experimental evidence doesn't justify it.

Tell that to a mainstream scientist and prepare yourself for a vitriolic reaction. But, the truth is, the bias of mainstream science that restricts all explanations to natural ones is a recent phenomenon. Historically, the greatest scientific minds have believed in a creative, supernatural power because it simply better explained what they observed and experienced.

Skeptics will counter, "Then, why do mutations exist at all? Why would a wise, benevolent, powerful God design DNA in such a way that mutations are inevitable?"

The traditional Christian response is that harmful mutations exist because of Humanity's rebellion to God's perfect order. The original humans were created genetically perfect, without harmful mutations. It was only after they disobeyed God and received the "death sentence" for their actions that harmful mutations were introduced.

Nevertheless, traditional Christians believe a day will come when harmful mutations will cease, death will not occur and all disease will be disappear. Humans, once again, will possess perfect bodies with perfect DNA.

And here's the thing. Everyone can possess this perfect body. It's not restricted to an elite group of people or membership into an exlusive club. The grace of God, offered through Jesus, has been extended to all of Humanity and just as Jesus was resurrected with a perfect body, so, too, will those who have placed their trust in him as their savior.

Such a simple thing, yet so hard for many.

The Problem of Protein Folding

2008-05-07T21:02:00.000-05:00

For any natural origin of life model to be credible, it must explain the development of the chemical interactions that transformed dead, inert matter into to living, goal-oriented, reproducing cells containing complex DNA. It's not enough to assume all living species evolved from common processes simply because they share common physical traits. One must show the transition from inert matter to living cells. Otherwise, claims regarding the model can only be based on speculation - not facts as evolutionists like to claim.

To better appreciate the problem consider the problem of protein folding. Proteins are the primary components of cells and execute nearly all cell functions. They supply skeletal structure and muscular growth and movement, they control our senses, they defend against disease and digest food. Examples of the protein types found in the human body:

1. Physiological: controlling such things as sight, smell, and hearing.

2. Structural: controlling the expansion and contraction of muscles and giving elasticity to connective tissues (collagen in bones, cartilages and tissues).

3. Transportive: moving materials such as oxygen (hemoglobin in blood) from the lungs to tissues.

4. Chemical: enzymes function to digest food and catalyze biochemical reactions that control and coordinate cell division. Receptor proteins receive stimulants and initiate responses in cells.

Because of the critical role they play, proteins are the most important molecules in living organisms. Without proteins cells can not live.

So, one question to ask proponents of natural origins is, "How did proteins originate?"

Regarding the composition of proteins, they are composed of amino acids. Human proteins, specifically, are composed of 20 different kinds of amino acids, 10 of which our body can produce by itself (non-essential amino acids) and 10 that must be obtained through food (essential amino acids). The human body contains approximately 100,000 proteins and every one of them are constructed from only 20 amino acids.

Moreover, excess amino acids are not stored like fats and starches so they must be constantly manufactured by the body and obtained from food. Failure to obtain even one of the essential amino acids severely compromises the body's ability to repair itself and sustain life.

Now, here's where things get especially interesting. Amino acids form the structure, or the shape - 3D shapes, actually - of proteins. More precisely, it's the amino acid sequence that determines the shape. The amino acid sequence is determined by the gene sequences in the cell's DNA. The gene sequences provide the code (known as codons) to link amino acids into proteins. More on this in a later post, but for now, suffice it to say that cells contain protein making mechanisms that link amino acids at a rate of almost 300 a minute.

Why so fast? Perhaps the rate is necessary to make the proteins functional. Proteins become functional only when they transform from their linear sequence of amino acid chains into 3-D structures. The process is called protein folding and is not understood by scientists.

In other words, the mechanisms that cause a linear chain of amino acids - that are functionally inert - to fold into 3-D structures - that are functionally active - in fractions of a second, is an issue that must be answered for a credible origin of life theory.

The problem is that protein folding is not explained by chemical reactions. Moreover, why do they form shapes at all? And why is it that only some shapes are beneficial for life and others are destructive? It's believed, for example, that malformed shapes are the cause for diseases like Alzheimer's, Cystic Fibrosis and Parkinson's disease. These questions are not answered by random chance.

In 1969, a scientist, Cyrus Levinthal calculated that a protein consisting of only 100 amino acids could theoretically form into as many as 10^30 possible shapes - that's 1 followed by 30 zeros. Even if a protein could change shapes 100 billion times per second, it take 100 billion years to try all the possibilities - longer than the Universe's age. Imagine the improbability of the largest protein, Titin, which consists of almost 27,000 amino acids!

Because of these issues, many scientists believe that discovering and explaining protein folding is the most important task in biochemistry.

Indeed, from my perspective, the complexities of the celluar mechanisms involved and the unlikeliness that proteins form beneficial shapes lead me to believe they originated from a Designer.

For additional information, see: The Importance of Protein Folding.

The Problem of RNA

2008-04-27T18:29:00.004-05:00

In my last post, I explained the reasons proteins are the most important molecules in our bodies for sustaining life. Proteins are produced by cells. To produce proteins, each cell contains a chemical factory that transcribes blueprints stored as genetic sequences into a coded message, transports the message outside the nucleus for processing and translates the message into proteins.

While it's not completely understood, each cell type (skeletal, brain, skin, etc.) knows when and where in the DNA to begin transcribing a particular gene sequence. Each gene sequence contains a region called the Promoter that indicates where to start transcribing the gene sequence and a Terminator which indicates where to stop.

The transcription process results in a single strand of base nucleotides called Ribonucleic Acid or RNA. Just as DNA contains an alphabet of four base nucleotides: A, T, C, G, RNA also contains an alphabet that represents it four base nucleotides: A, U, C, G. To construct a word in the RNA language, three of these letters are grouped together to form a codon, for example: ACG. The letters need not be unique, so UUU is also a valid codon.

The difference between DNA and RNA is that the nucleotide uracil in RNA replaces thymine in DNA.

Recall the DNA has two complementary strands bonded in a double-helix. When transcription begins, the two DNA strands split. Scientists refer to the two strands in different ways, but, essentially, one strand, call it the Template Strand, provides the pattern for transcription and the other strand, call it the Non-template Strand is the strand being transcribed. The promoter region is located on the Non-template strand.

non-template strand: CTGCCATTGTCAGACATGTATATA
template strand: GACGGTAACAGTCTGTACATATAT

An enzyme called RNA polymerase reads the two DNA strands to produce the RNA message chain which is the complement of the DNA template strand. Notice that since the DNA template stand and the non-template strand are also complementary, it follows that that the RNA message is a copy of the original, non-template strand (with uracil replacing thymine).

non-template strand: CTGCCATTGTCAGACATGTATA
template strand: GACGGTAACAGTCTGTACATAT (complement of non-template strand)
RNA produced: CUGCCAUUGUCAGACAUGUAUA (complement of template strand)

Once the RNA is produced, it is transported out of the nucleus into the cytoplasm so the process of protein construction can begin. During construction the codons in the RNA message are read by a chemical bar code reader called the ribosome. The ribosome maps, or translates, the RNA codons to amino acids and connects them into a polypeptide chain which will later be folded into a protein. The amino acids are brought to the ribosome by transfer RNA (tRNA) molecules.

The process of producing proteins from RNA is called Translation.

While my description is overly simplified, in actuality, the transcription of DNA into RNA, the transportation of RNA out of the cell's nucelus and into the cytoplasm and the translation of the RNA message is very complex. Failure of any component or step will likely result in harmful results. If the DNA codons are incorrectly translated or transcripted, the resulting protein will not function in the way it should. Muscular Dystrophy, for example, is believed to be the result of a premature termination of RNA translation.

The challenge for science is to explain the origins of RNA in the context of pure naturalism. To their credit, most biologists and geneticists realize and accept the challenge. They firmly believe the scientific method will reveal the natural origins of RNA.

Not me. For me, it's easier to believe a super-creative Mind created and initiated the entire process. The process is too complicated and relies on too many collaborating cellular mechanisms to have occured naturally.

Opponents might ask, "Then why didn't this Super-Mind create a perfect process? Why do mistakes occur that result in diseases like Muscular Dystrophy?"

My response is that these mistakes were not originally present in the original DNA and RNA, but came about as the result of humanity's rejection of its Creator. Though our present bodies may decay and die - the consequence of rejecting the Creator - it's possible to one day possess a perfect body with perfect DNA that perfectly constructs and maintains proteins.

Today, that's not so far fetched. We are not gods but even we hope to use genetic medicine to correct nature's malfunctions and reverse aging . If we can do this, if we can understand our genome well enough to mitigate the risk of malfunctions, surely a more advanced, Super-Intelligence would, too.

Therefore, I think it is more rational to believe a Super Intelligence initiated the processes that resulted in all the cellular processes and mechanisms we observe.

For additional details, see:

DNA-RNA-Protein
From DNA to RNA
Learn Genetics
Learning Your A, G, C's (and T, too)

The Argument from Induction

2008-04-26T17:46:00.000-05:00

Belief in God is not only rational, but scientific. My argument is based on the following reasoning. I call it the Argument from Induction:

P1: Scientific experiments produce data models.
P2: Hypothesis formed from a data model using logical induction are deemed scientifically justified.
P3: The existence of God can be hypothesized from the data model.
Thus, belief in God is scientifically justified

A. Support for P1:Scientific experiments produce data models
The two approaches to forming scientific theories and producing a data model are:

1. Propose a hypothesis and attempt to refute it using experimentation
2. Collect data through experimentation and form the hypothesis

The two approaches are often used interchangeably, but there's a distinct difference between them. Forming an initial hypothesis, before experimentation, can lead to an unconscious bias that seeks to verify the hypothesis and reject the evidence that falsifies it. For example, before Galileo, scientists might have reasoned thusly:

Hypothesis: The Earth is the center of the Universe.
P1: The sun consistently rises in the east, travels across the sky and disappears in the west.
P2: The moon also travels in the same manner as the sun.
P3: The stars and constellations in the universe change their position as they move around the earth.
Therefore, since all heavenly bodies are observed to move across the earth's sky, the earth is the center of the universe.

Galileo falsified the geocentric (earth centered) hypothesis with the Copernican heliocentric (sun centered) hypothesis using data obtained from his astronomical observations. He used the second scientific approach where [a] an initial question is asked, such as, "Is the Earth the Center of the Universe?", [b] experiments are performed to produce a data model from which [c] the hypothesis is formed. I believe this methodology to be more accurate because the hypothesis can change as the data model changes.

In other words, as more knowledge is discovered, the hypothesis becomes more refined.

B. Support for P2:Hypothesis formed from a data model using logical induction are deemed scientifically justified.
Galileo's reliance on experimental data to refute the hypothesis of the earth's centrality lead Frances Bacon to argue in favor of an inductive approach where a hypotheses is formed after a data model has been constructed from repeated and verifiable experiments.

Moreover, the inductive approach predicts the same result will be repeated under similar circumstances, forming the basis for the modern mainstream belief that nature operates uniformly across the Universe.

For example, regarding the weak nuclear force modern scientists might reason thusly:

Datum 1: All matter is composed of atoms.
Datum 2: An Atom contains protons and electrons that form the atom's electrical charge.
Datum 3: Occasionally, protons change into neutrons and neutrons change into protons.
Datum 4: When the change occurs, a particle is emitted that maintains the atoms electric charge.
Datum 5: The change occurs too slowly for the Strong Force and the other known forces to account for it.
Induction: A very weak force must be responsible for the change.
Induction: Since it occurs within atoms, the weak force is fundamental to the laws of nature and is present in all atoms in the Universe.

For the most part, the science of Quantum Physics has been and continues to be inferred using the inductive approach.

However, there are problems with the inductive approach, the chief of which is the one introduced by philosopher David Hume who argued that, "...no man, having seen only one body move after being impelled by another, could infer that every other body will move after a like impulse. All inferences from experience, therefore, are effects of custom, not of reasoning."

Hume can be tough to digest for modern readers, but essentially, Hume argues logical induction is circular and can't be proven reliable. In more practical terms it means that one can't predict all sheep are white because only white sheep have been observed.

Thus, while the existence of the weak force may be a valid inference, to claim it exists uniformly and consistently throughout the universe is not.

Nevertheless, based on work by Mathematician Henri Poincaré, while experimental evidence may not guarantee certainty and uniformity, it increases the probability for them. Hence, Poincaré introduced the modern bias that experimentation, over time, produces a data model that strengthens or weakens the hypothesis. Thus, hypothesis that are formed from the data model using logical induction are deemed scientifically justified

Scientific fact, in reality, is not objective fact - it is an interpretation of the data model that its promoters believe has been strengthened by experimentation.

C. Support for P3:The existence of God can be hypothesized from the data model.
The fine tuning of the Universe, for example, is said to have occurred by random chance. There is an alternative interpretation that is just as rational. I argue the existence of God is not only rational, but also scientific since the same empirical data model is used to infer his existence.

For instance, consider the aforementioned weak force. If it were slightly stronger, lighter elements with smaller atomic numbers would fuse into heavier elements (with larger atomic numbers) more quickly because their neutrons would be transformed into protons (Datum 4 above). This would prevent simple, life sustaining molecules, like water, from forming because all the hydrogen would be turned into helium.

If the weak force were slightly weaker, there would be an abundance of lighter elements in the Universe (hydrogen and helium), but, little, if any, of the life forming heavier elements - like oxygen, nitrogen and carbon.

Therefore, the weak force must be tuned just right so life as we know it can form. The fact that the weak force is finely tuned is not controversial What is controversial is the reasons for its tuning. Is it from chance or from an intelligence?

Furthermore when one considers the extremely fine tuning of the other fundamental constants, it seems to me far more rational to infer the existence of an intelligent Mind who established these parameters than inferring random chance.

The God Induction
To factually claim the Universe resulted from chance is not justifiable from the scientific data alone. One must impose one's beliefs to suggest that induction. Given alternative inductions are possible from the data, as I've demonstrated, it is logical to suggest the Universe resulted from an intelligent source.

Thus, belief in God is scientifically justified.

Additional Reference
In addition to links embedded in the text, the following paper provides an excellent examination of the origins of the hypothesis, the philosophical reasoning and inductive logic that undergirds it and the implications for experimental design.
A Brief History of the Hypothesis

God Gene is Bad Science

2008-04-26T17:00:00.000-05:00

Does a God Gene exist? No, and I argue this is just bad science and all of us should refrain from submitting bad science as evidence for anything.

Essentially, the God gene hypothesizes that (some) human beings are genetically predisposed to a belief in God. The idea is based on the book, The God Gene: How Faith is Hardwired into our Genes by Dean Hamer.

Simply put, there's no, and I mean, none, zip, zero, experimental evidence to support the God gene. Period. Still, even if such a gene existed in no way would it refute the existence of God, nor would it refute the religious experiences people have.

We already know the brain possess cognitive structures and chemical reactions that interpret sensory information - correct? Yet, we don't argue the objects our senses report are all in our head do we? Why not? Aren't all experiences merely the result of chemical processes and structures that exist only in our heads? To answer in the affirmative would be preposterous!

It's the same with the God Gene. Just because the brain is wired to sense deity doesn't mean deity is imagined. Besides, the Human Genome Project has scientifically demonstrated that humans are a complex mix of many interacting genes and environmental pressures - not from a single gene.

In short, the idea has no scientific credibility and even Hamer has since disowned the title of his own book.

If one wants to make a philosophical argument for the God Gene, and refer to scientific evidence to strengthen their argument - fine, but keep in mind the speculative nature of the subject…and it pays to keep current on the latest developments in science.

I say, when discussing religion and science, it’s important to be intellectually honest.

That’s my 2 cent argument, rip it to shreds if you can.